Poult. Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Poult Sci 2006. 85:1980-1986
© 2006 Poultry Science Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huber, K.
Right arrow Articles by Rodehutscord, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huber, K.
Right arrow Articles by Rodehutscord, M.

PHYSIOLOGY, ENDOCRINOLOGY, AND REPRODUCTION

Adaptation of Epithelial Sodium-Dependent Phosphate Transport in Jejunum and Kidney of Hens to Variations in Dietary Phosphorus Intake

K. Huber*,1, R. Hempel{dagger} and M. Rodehutscord{dagger}

* Physiologisches Institut, Stiftung Tierärztliche Hochschule Hannover, Germany; and {dagger} Institut für Ernährungswissenschaften, Martin-Luther Universität, Halle (Saale), Germany

1 Corresponding author: korinna.huber{at}tiho-hannover.de


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The objective of this study was to explore the homeostatic response of jejunal and renal epithelia regarding the inorganic phosphate (Pi) transport capacities to variations in dietary total phosphorus (tP) supply in hens. Adaptive processes were determined by quantitative measures of intake and excretion, Pi transport studies across brush border membranes, and semiquantitative detection of sodium-dependent phosphate transporters (NaPi II) based on mRNA expression in the jejunum and kidney. Twelve hens (4/group) were adapted to 3 tP feeding levels in a pair-fed manner (60 g/d): low P diet with 0.073% tP, medium P diet with 0.204% tP, and high P diet with 0.343% tP. Excretion was measured during the last 5 d of a 16-d feeding period. After slaughtering, jejunal mucosa and renal cortex were removed. Tissues were used for 32P uptake studies in brush-border membrane vesicles by rapid filtration technique and NaPi II mRNA expression studies by northern analyses. Plasma Pi concentrations were additionally measured. The NaPi II transporter mRNA could specifically be detected in chicken jejunum and kidney. Functional parameters of Na+-dependent Pi transport indicated that these transporters were involved in chicken Pi transport across the apical membranes of jejunal and renal epithelia. Increased tP intake resulted in an increased overall tP excretion. Correlating individual data from all animals by linear regression highlighted that the adaptive decrease of renal Pi transport capacity and NaPi IIa mRNA expression was associated with an increase in plasma Pi levels and resulted in a higher tP excretion. Jejunal Pi transport capacity and NaPi IIb mRNA expression did not react to variations in dietary tP supply. In conclusion, the homeostatic response was mainly based on the adaptive capacity of the kidney in hens.

Key Words: hen • inorganic phosphate transport • kidney • jejunum • NaPi type II cotransporter


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Balance studies with quantitative measurements of intake and excretion of total P (tP) are difficult to interpret with regard to the effects of variable supply of dietary tP on P homeostasis because excreta contain tP from feces and urine in different proportions and different dietary ingredients differ in P availability. Rodehutscord et al. (2002) studied the effects of supplementing an inorganic P source to a low-P basal diet in hens and compared tP flow at the terminal ileum with tP excretion. Whereas the prececal net absorption of supplemented tP in the small intestines was very high (90%), supplemented P was almost completely recovered in excreta in this study. Van der Klis et al. (1997) found that the prececal net absorption of supplemented tP in hens was 87%. These data suggest that the kidney plays the dominant role in hens in the adaptation to variable P intake. However, the adaptive capacities of intestines and kidney cannot separately be examined in balance studies. Combining balance trials with functional and structural studies on inorganic phosphate (Pi) transport mechanisms in respective organs mainly relevant for P excretion promise a more detailed view of P homeostatic processes in chicken. In chicken epithelia, the first step of Pi absorption is a secondary active, Na+-dependent process across the brush border membranes in the small intestine and the kidney (Renfro and Clark, 1984; Quamme, 1985). On molecular level, Na+-dependent Pi transporters of the solute carrier (SLC) 34 family are detected in chicken kidney (NaPi IIa, SLC34A1) and in chicken small intestine (NaPi IIb, SLC34A2; Werner and Kinne, 2001). Effects of dietary tP restriction on P homeostasis in chicken are not extensively studied with a combination of quantitative, functional and structural approaches. Therefore, it was the aim of this study to explore the overall P balance, the jejunal and renal Pi transport capacities and the expression levels of the regulatory important Na+-dependent Pi transporters at different P feeding levels in hens.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Diets, Animals, and Feeding
Three diets were used. The ingredients of the diets were chosen to allow for a very low P concentration in the basal diet (Table 1Go). Rice flour, ground sugar beet pulp, and dried egg albumen were the main ingredients with a presumably low P availability. Energy and all other nutrients were contained at least at levels recommended by the Gesellschaft für Ernährungsphysiologie (1999). In 2 other diets the tP contents were increased by inclusion of monobasic calcium phosphate [Ca(H2PO4)2] at levels of 5 and 10 g/kg at the expense of limestone. All ingredients with the exception of the variable ones were mixed in 1 batch to ensure uniformity of the mix. This mix was divided in 3 portions, and monobasic calcium phosphate was then included at the respective level. The analyzed tP concentrations in the diets were 0.73 g/kg (low P; LP), 2.04 g/kg (medium P; MP), and 3.43 g/kg (high P; HP).


View this table:
[in this window]
[in a new window]
  		Table 1. Composition of the basal diet
 
Twelve 24-wk-old hens (Lohmann Brown) were kept individually in balance crates and allocated to 1 of the 3 diets randomly (n = 4 hens per diet). For a period of 15 d, the feed was placed into the crop in a 12-h interval through a flexible plastic tube after addition of tap water at a rate of 60 g of feed/d. This procedure was chosen because we intended to avoid the high variation in feed intake that was observed in previous trials and that had caused additional variation in tP intake. The feeding level was chosen on the basis of the voluntary intake of a tP-deficient diet by hens measured previously (Hempel et al., 2004). Hens responded to the low intake with a decrease in laying performance, and no eggs were laid at the end of the experiment. The mean BW of the hens at the end of the experiment was 1.46 kg. The experiment was approved by the animal welfare authorities [Approval No. 2-643 MLU Hal, Landesverwaltungsamt Sachsen-Anhalt, Halle (Saale), Germany] in accordance with the German Animal Welfare Regulations.

Excreta Collection and Analyses
At the end of the experiment, excreta were quantitatively collected for 5 consecutive days from trays underneath the crates once daily. Excreta were bulk-stored at –18°C for each hen separately. Thawed excreta were thoroughly mixed, weighed, and analyzed for dry matter content. Excreta were freeze-dried and ground through a 0.5-mm screen prior to analysis. Samples of feed and excreta were hydrolyzed using H2SO4 and HNO3. Concentrations of tP and Ca were determined with an Inductively Coupled Plasma Spectrometer (ICP-OES; JY 24, Jobin Yvon GmbH, Grassbrunn, Germany) with details as given by Rodehutscord and Dieckmann (2005).

Tissue Sampling
At the end of the experiment hens were slaughtered conventionally. Blood was collected during slaughtering, centrifuged at 600 x g at room temperature, and resulting plasma was stored at –20°C until analyses. The gastrointestinal tract was removed from the body cavity completely. Chymus samples were collected from the small intestines if available. Jejunum of hens was removed, cut open, washed in ice-cold saline, and shock-frozen in liquid N. A small piece of jejunum was separately dissected to isolate mucosa by scraping it off the underlying tissue for RNA isolation. Kidneys were removed completely, were washed in ice-cold saline, and were also shock-frozen in liquid N. Tissues were stored at –80°C until analyses.

Determination of Plasma and Chymus Pi and Ca Concentrations
Plasma and chymus Pi was determined colorimetrically using the vanadate-molybdate method (Kruse-Jarres, 1979) and Ca by the standard o-cresolphthaleine complex method (Sarker and Chaunan, 1967).

Functional Characterization of Epithelial Phosphate Transport in Jejunum and Kidneys
Brush border membrane vesicles (BBMV) were prepared from jejunal and renal epithelia by a modified Mg2+-EGTA precipitation method (Schröder and Breves, 1996). Enrichment of the brush border membrane in the final vesicle preparations compared with the initial total homogenates was determined by marker enzyme activities [alkaline phosphatase (AP) for brush border membrane, Na+-K+-ATPase for basolateral membranes]. Protein concentration was assayed by applying the DC method from BioRad (Hercules, CA).

The Na+-dependent Pi uptake into BBMV was quantified using the rapid filtration technique as described by Schröder and Breves (1996) and Schröder et al. (2000) for caprine intestinal and renal BBMV. In general, 20-µL portions of vesicle suspensions containing 160 to 300 µg of protein were mixed with 80-µL transport buffer containing 1.0 µCi 32P and nonlabeled Pi to create an inwardly directed Pi gradient. Extravesicular incubation buffers (100 mmol/L of mannitol, 10 mmol/L of HEPES/Tris) contained 100 mmol/L of NaCl to create an inwardly directed Na+ gradient or 100 mmol/L of KCl to detect the diffusional component of Pi uptake. The mixtures were incubated at room temperature until the reactions were stopped by mixing them with ice-cold stop solution and immediately filtered by vacuum suction. The filters were washed twice with 5 mL of ice-cold stop solution to remove extravesicular radioactivity. The stop solution contained 10 mmol/L of HEPES/Tris buffer, 150 mmol/L of KCl, and 1.0 mmol/L of KH2PO4 (pH 7.4 at 4°C). Filters with washed BBMV were then transferred into vials with 4 mL of scintillation liquid (Lumasafe plus, Lumac LSC B.V., Groningen, the Netherlands). Measurement of radioactivity was performed in a liquid scintillation counter (TriCarb 2500 TR, Packard Instruments Co., Meriden, CT).

Time-Dependent Pi Uptake
Time-dependent accumulation of Pi in jejunal BSMV was determined from 10 s up to 4 h at 37°C in the presence of 100 mmol/L of Na+ or K+ to verify the integrity of vesicles and the Na+-dependency of Pi transport. Time-dependent Pi uptakes of renal BBMV could not be performed because of low yield of BBMV.

Pi Concentration-Dependent Pi Uptake
The Pi uptake was measured at 0.01, 0.05, 0.1, 0.3, 0.5, and 1.0 mmol/L of Pi in the extravesicular incubation buffer in the presence of Na+. Additionally, at a Pi concentration of 0.1 mmol/L, Pi uptake was measured in the presence of 100 mmol/L K+ to estimate the extent of the Na+-independent, diffusible part of Pi uptake at this Pi concentration and to ensure by the difference between Na+-dependent and -independent Pi uptake rates the integrity of the vesicle during uptake studies. This diffusible Pi uptake value was not used to calculate the kinetic parameters.

The Na+/Pi uptake was calculated as total Pi uptake minus Na+-independent Pi uptake. The Na+-independent part of Pi uptake was calculated by using a modified equation according to Michaelis-Menten. The Michaelis-Menten equation was extended by the term (+ A·x) to introduce A as the estimated diffusible part of Pi uptake. Kinetic parameters Vmax (nmol Pi/mg protein/10 s) and Km (µmol Pi/L) were calculated fitting the Pi uptake rates in the presence of Na+ to y = Vmax·x/(Km + x) + A·x, where y is the Na+/Pi uptake in nmol Pi/mg of protein/10 s and x = substrate (Pi) concentration in mmol/L. These values were fitted to all measured x and y values to create an optimal curve with highest correlation coefficient. The Vmax represents the transporter capacity, and Km is the Pi concentration at which the transporter is half-maximal saturated and that represents the affinity of the transporter for Pi. Fitting Pi uptake rates to the above-mentioned algorithm was performed using Graphpad Prism software (Version 2.01, GraphPad Software Inc., San Diego, CA).

Structural Characterization of Epithelial Phosphate Transporters in Jejunum and Kidneys: NaPi IIb-Specific Reverse Transcription-PCR in the Jejunum
The RNA from the jejunum of hens was isolated using a commercial kit (Qiagen, Hilden, Germany). Using 500 u MMuLV (moloney murine leukemia virus) reverse transcription (MBI Fermentas, Vilnius, Lithuania), poly(A)+RNA were transcribed into cDNA. The PCR was performed at the following reaction conditions: 1x reaction buffer (200 mmol/L of Tris-HCl, pH 8.4, 500 mmol/L of KCl), 0.4 mmol/L each dNTP, 1.5 mmol/L MgCl, 2.5 u Taq polymerase (Gibco BRL, Gaithersburg, MD), 20 pmol of each primer, and 1.5 µL template in a total volume of 25 µL. Using a Mastercycler gradient (Eppendorf, Wesseling-Berzdorf, Germany), 34 cycles were run with denaturing for 30 s (after an initial denaturing for 2 min at 94°C) at 94°C, annealing for 1 min at 60°C, and elongation for 2 min at 72°C. Finally, there was an elongation time of 15 min at 72°C. Specific primers were derived from bovine kidney cell line NaPi IIb mRNA sequence (Acc. No. X81699 [GenBank] ): sense 5'atggtggcctcctcactgctg3' (nucleotides 609–629), antisense 5'tggggtcatagcagacgtgaa3' (nucleotides 1406–1429). A band of 819 bp could be detected by agarose gel electrophoresis, which was identified by cloning and sequencing (sequenced by Agowa, Berlin, Germany). This DNA fragment was used for detection of chicken-specific NaPi IIb-mRNA in jejunum of the hens. For the detection of chicken NaPiIIa in kidney, a goat-specific probe was used. This probe was created by reverse transcription-PCR using primers derived from the core region of murine NaPi IIa nucleotide sequence, which reflected the transmembrane regions of the corresponding NaPi IIa protein. Transmembrane regions of Pi transporters were strongly conserved within the animal kingdom and also in chicken. High homology of NaPi IIa structure was confirmed by detection of NaPi IIa protein using a murine NaPi IIa antibody (Dudas et al., 2002). Hybridization with this probe resulted in a strong 2.4 kb band in northern analysis that was the expected NaPi IIa mRNA size, indicating an adequate cross homology in chicken.

Northern Blot Analyses
Semiquantitative detection of specific NaPi IIa and IIb mRNA of jejunum and kidney was performed as described in detail by Huber et al. (2002). In brief, RNA was isolated by acid phenol/chloroform extraction, and jejunal poly(A)+RNA was enriched by affinity chromatography using an oligo-dT cellulose binding matrix. Renal RNA (40 µg/lane) or jejunal poly(A)+RNA (5 µg/lane) were fractionated in 1.0% formamide/agarose gels and transferred by capillary blotting onto nitrocellulose membranes. Transferred RNA was fixed on the nitrocellulose membrane by heating at 80°C under vacuum. Fixed mRNA were hybridized to radioactively labeled NaPi IIa-, -IIb and ß-actin-specific probes. Labeling was performed with 50 µCi [{alpha}32P]dCTP per probe using Readyprime II random prime labeling kit according to the manufacturer’s protocol (Amersham Biosciences Europe, Freiburg, Germany). The membranes were analyzed after exposure to a phosphorus imager screen for 2 to 4 h with a phosphorus imager system (BioRad, Munich, Germany). The relative amounts of specific mRNA were quantified by reference to ß-actin as an internal standard using the quantification software Quantity One (BioRad). Northern blots were performed at least in duplicate.

Statistics
Values are given as means ± SD. Statistical analyses and linear regressions were performed with the software Graphpad Prism version 2.01. One-way ANOVA with Tukey’s post test was used to compare means of LP, MP, and HP. Levels of significance were set at P < 0.05, P < 0.01, and P < 0.001.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effect of Dietary High Ca and Low tP Intake on Kidney Integrity
Diets containing 3% Ca and less than 0.6% available P (aP) could generate urolith formation in chickens caused by alkalinization of the urine. Urolithiasis caused kidney tissue damage, tubular degeneration, and interstitial nephritis, which could result in a high mortality of hens (Wideman et al. 1985, 1989). Although predisposition regarding urolithiasis generation might have been relevant with the experimental feeding design used, neither uroliths nor mineralization of renal medullary regions were found macroscopically. Also, morphology and size of kidneys was unchanged, indicating the lack of compensatory hypertrophic growth of undamaged renal tissue. Histological examination of hematoxylin-eosin stained kidney tissue slices did not show signs of inflammation or tissue lesion.

Effects of Dietary tP Intake on Pi and Ca Plasma or Chymus Concentrations and tP Excretion
Plasma Pi concentrations in hens increased with increased dietary tP intake from LP to MP, reaching a plateau at about 1 mmol/L in MP and HP groups. Plasma Ca concentrations were significantly enhanced in LP compared with MP and HP groups, indicating a P depletion status only in the LP group (Table 2Go). Concomitantly, Pi concentrations in small intestinal chymus increased with increasing dietary tP intake, whereas Ca concentrations seemed to be constant (Table 2Go). But it has to be taken into account that determination of electrolytes in chymus is difficult because of strong variations in collectable amounts of chymus. Therefore, electrolyte concentrations could not reflect the physiological situation absolutely.


View this table:
[in this window]
[in a new window]
  		Table 2. The inorganic phosphate (Pi) and Ca concentrations in chicken plasma and intestinal chymus1
 
Hens from the LP group were in a negative P balance (Table 3Go). With increased dietary tP intake, hens doubled their tP excretion from the LP to HP group significantly. The dependency of plasma Pi concentrations and tP excretion on dietary tP intake is shown in Figure 1Go. From LP to MP plasma Pi concentrations and tP excretion increased both, but from MP to HP the increase in tP concentration was more pronounced, whereas plasma Pi concentrations were maintained at about 1 mmol/L. Overall, tP excretion was strongly dependent not only on dietary tP intake but also on plasma Pi concentration (Figure 2Go).


View this table:
[in this window]
[in a new window]
  		Table 3. Daily dietary total P (tP) intake, tP excretion, inorganic phosphate (Pi) transport capacities (Vmax) in jejunum and kidney and expression level of jejunal and renal NaPi type II transporters1
 

Figure 1
View larger version (12K):
[in this window]
[in a new window]
  		Figure 1. Dependency of plasma inorganic phosphate (Pi) concentrations (filled circles) and total P (tP) excretion (open circles) on dietary tP intake. LP = low P diet; MP = medium P diet; HP = high P diet.

 

Figure 2
View larger version (8K):
[in this window]
[in a new window]
  		Figure 2. Relation between plasma inorganic phosphate (Pi) and total P (tP) excretion. One hen of the medium group P was omitted because of its low tP excretion despite high plasma Pi concentration. Linear regression resulted in r2 = 0.68, P < 0.01 significance of deviation of the slope from zero.

 
Parameters of Pi Uptake in Jejunal and Renal BBMV
Apical located alkaline phosphatase activity was enriched 6.9 ± 1.3-fold and 9.4 ± 1.0-fold in LP, 5.4 ± 0.8-fold and 7.5 ± 1.2-fold in MP, and 6.2 ± 0.5-fold and 13.6 ± 2.4-fold in the HP group in jejunal and renal BBMV, respectively. The Na+K+ATPase activity located in the basolateral membrane was enriched 1.3 ± 0.6-fold and 2.4 ± 1.4-fold in LP, 1.0 ± 0.2-fold and 1.7 ± 0.9-fold in MP, and 1.6 ± 1.1-fold and 1.3 ± 0.5-fold in HP group in jejunal and renal BBMV, respectively. These enrichment values were comparable with those obtained in BBMV preparations of goats and pigs and were set to be adequate for studying Pi transport processes across the apical membranes. Contaminations by basolateral membranes were comparably low in all feeding groups. Integrity of BBMV was confirmed by measuring time-dependent Pi uptakes into the vesicles of 1 hen of each group (Figure 3Go). Intravesicular Pi accumulations were observed in the presence of 100 mmol/L Na+ in the incubation buffer, whereas incubation with 100 mmol/L K+ resulted in low linear Pi uptakes into jejunal BBMV. These results confirmed the presence of a Na+-dependent Pi transport system in the apical membranes of jejunal enterocytes whereas K+-dependent Pi uptake reflected only the diffusible part of Pi uptake. This diffusible part was low and uninfluenced by dietary P supply. Time- and Na+-dependent uptake of Pi into the vesicles showed an overshoot phenomenon in each BBMV preparation. Elongation of incubation time up to 4 h did not result in equilibrium because of the low incubation temperature at about 18°C.


Figure 3
View larger version (11K):
[in this window]
[in a new window]
  		Figure 3. Time-dependent inorganic phosphate (Pi) uptake in jejunal brush border membrane vesicles of 3 hens in the presence of 100 mmol/L Na+ (closed symbols) or K+ (open symbol) in the incubation buffer. Each point represents the mean of 3 measurements of 1 individual hen; {blacksquare} = low P diet (LP) hen, {blacktriangleup} = medium P diet (MP) hen, {blacktriangledown} = high P diet (HP) hen, {diamond} = mean values of K+ dependent Pi uptake of LP, MP, and HP hens (standard deviation was <0.016 nmol/mg of protein/10 s).

 
The Pi concentration-dependent Pi uptake in jejunal and renal BBMV was performed to calculate Vmax and Km values of Pi transport as dependent on dietary tP supply. Mean Vmax values representing the mean Pi transport capacity were highest in the LP group and tended to decrease to HP group in the jejunum (64, 46, and 43 pmol/mg of protein/10 s) but more pronounced in the kidney (1.87, 1.01, and 0.49 nmol/mg of protein/10 s; Table 3Go). However, in both organs these decreases were not significant. Mean Km values representing mean transporter affinity were not affected by the dietary tP supply. In jejunum and kidney, the mean Km values were 45 and 104 µmol/L in LP, 43 and 75 µmol/L in MP, and 38 and 92 µmol/L in HP group, respectively.

NaPi Type II mRNA Expression Levels in Jejunum and Kidney
Hybridization of mRNA with a chicken-specific NaPi IIb probe created on chicken jejunal cDNA resulted in a strong signal at about 4 kb. Detection of renal NaPi IIa mRNA with a goat-specific probe revealed a strong band at about 2.4 kb in northern analysis. Both mRNA signals were in the expected size range for these transporters, indicating the specificity of the detection. Whereas the NaPi IIb mRNA level significantly increased from the LP to HP group, NaPi IIa mRNA level decreased successively from LP to HP (Table 3Go). However, this decrease in NaPi IIa mRNA expression was not significant.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The Pi homeostasis in chickens influenced by dietary tP supply is affected by the adaptive capacities of small intestines and kidney, like in mammalian species. The aim of this study was to characterize the basic functional and structural principles of Pi transport in the jejunum and kidney. Influenced by variations of dietary tP supply, the adaptation of epithelial Pi transport processes was combined with balance data and plasma Pi concentrations to assess the physiological role of each of these components of Pi homeostasis.

Epithelial Pi Transport in Hens
Apical-located NaPi IIb and NaPi IIa transporters represent the rate-limiting steps for transepithelial Pi transport in jejunal and renal epithelia. Physiological regulation of Pi transport capacities of renal and jejunal epithelia is mediated by changes in the abundance of these transporters (Murer et al., 2004). In hens, NaPi IIb and NaPi IIa mRNA could be detected in jejunum and kidney specifically. Because antibodies against the respective proteins are not available, BBMV uptake studies were performed to characterize jejunal and renal Na+-dependent Pi transport functionally. The Km value for Pi is characteristically low in Na+-dependent Pi transport mediated by NaPi IIb at about 50 µmol/L, indicating a high Pi affinity (Murer et al., 2004). In chicken jejunum, Km(Pi) values of all groups were equally low at about 40 µmol/L, indicating that Na+-dependent Pi transport is mediated by NaPi IIb in this species also. In kidney, apparent Pi affinity was 100 µmol/L for Na+-dependent Pi transport mediated by NaPi IIa (Murer et al., 2004). In chicken kidney a comparable Pi affinity was detected indicating that renal Na+-dependent Pi transport was also mediated by NaPi IIa. The existence of NaPi IIa in chicken should be associated with the existence of mammalian-type nephrons in chicken kidneys because, hypothetically, the evolution of NaPi IIa was paralleled by development of this type of nephrons (Werner and Kinne, 2001). But Pi reabsorption capacity in the proximal tubuli mediated by NaPi IIa is only one factor for influencing renal Pi excretion. From elegant studies on renal Pi excretion in birds influenced by parathyroid hormone (PTH) and variations in dietary aP supply, a tubular Pi secretion was detected that is not expressed in mammalian species. This mechanistically unknown Pi secretion was stimulated by PTH irrespective of dietary aP supply (Wideman, 1987; Stanton et al., 1989). At which extent this Pi secretion participates in the adaptation to variations in dietary aP is still unclear, but PTH levels should be low at the relatively high dietary Ca intake in hens of this study. Therefore, adaptation to variations in dietary aP should be modulated by tubular Pi reabsorption mediated by NaPi IIa. To summarize, the assumption that NaPi II-mediated Pi transport mechanisms exist in kidney and jejunum of hens was proven by the presence of NaPi IIa and IIb mRNA and the concordance of functional characteristics of Na+-dependent Pi transport with those known from NaPi IIa- or IIb-mediated Pi transport processes in mammalian species.

Adaptation of Epithelial Pi Transport Influenced by Dietary P Restriction
Regulation of P homeostasis in chicken should be analogously based on adaptive changes in NaPi II expression and Na+/Pi transport capacity, like in mammals (Werner et al., 1994; Murer et al., 2000; Huber et al., 2002; Radanovic et al., 2005). However, functional (Vmax) and structural (NaPi II mRNA expression) parameters were not changed significantly by dietary P restriction when the experimental groups were compared. Neither chymus nor plasma Pi concentrations influenced intestinal Pi absorption. It is noticeable that plasma Pi levels lowest in LP group were combined with hypercalcemia, indicating strong P restrictive feeding. Plasma levels of MP and HP group were only slightly higher than in LP but did not reach the level of adequate tP-fed chickens (1.2 to 1.8 mmol/L; Boorman and Gunaratne, 2001). This could be due to the restricted amount of feed that was to be given in this study to standardize tP intake. This restriction in feed also caused a decrease in egg production of the hens, which also interacts with the homeostasis of Ca and P. Therefore, plasma Pi levels did not reach higher values.

However, increased plasma Pi levels significantly caused increased tP excretion, which could be the result of a decreased intestinal or renal Pi absorption or both. Correlations of individual data of all animals between renal and jejunal Pi transport capacities, NaPi IIa and IIb mRNA expression, plasma Pi levels, and tP excretion by linear regression highlighted significant relations between renal functional and structural parameters of Pi transport and plasma Pi or tP excretion (Table 4Go). The Vmax of renal Na+-dependent Pi transport as well as NaPi IIa mRNA expression was significantly reduced by increased plasma Pi levels, which gave rise to decreased renal Pi absorption capacity. As a consequence, renal Pi excretion should increase, which was supported by the significant negative correlation between renal Vmax and tP excretion (Table 4Go). In the jejunum Pi transport capacity, NaPi IIb mRNA expression, plasma Pi levels, and tP excretion were generally not correlated with each other. Therefore, Pi absorption and NaPi IIb expression was obviously not modulated by dietary tP supply in the jejunum of hens. In the study by Rodehutscord et al. (2002) an increased intake of tP resulted in an increased tP excretion of hens, but differences in the amount of tP measured in the terminal ileum were hardly found. The authors had suggested that the kidneys rather than the intestines play a major role in adaptation to variable tP intake, which is confirmed by the results from the present study.


View this table:
[in this window]
[in a new window]
  		Table 4. Correlations between renal and jejunal inorganic phosphate (Pi) transport capacities (Vmax), sodium-dependent phosphate transporters (NaPi IIa and IIb) mRNA expression levels, plasma Pi concentrations, and total P (tP) excretions
 
In the duodenum of cockerels, Na+-dependent Pi transport was increased by dietary P restriction (Quamme, 1985). This difference to the findings from the present study could be due to the fact that that study was performed in younger, rapidly growing cockerels, in which disturbances of P homeostasis by dietary P restriction could be more relevant due to the higher P requirement. Additionally, another segment of the small intestines was examined, which could result in location-dependent effects on Pi absorption.

It is still unclear why jejunal NaPi IIb mRNA expression in the hens increased with increased dietary tP intake.

In conclusion, the adaptive capacity of the kidney regarding the Pi transport had the most important role for regulation of P homeostasis in these hens. Plasma Pi level seemed to have a relevant modulatory influence on renal Pi reabsorption capacity in chickens as it was observed in mammals (Widiyono et al., 1998).

Received for publication March 20, 2006. Accepted for publication May 4, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Boorman, K. N., and S. P. Gunaratne. 2001. Dietary phosphorus supply, egg shell deposition and plasma inorganic phosphorus in laying hens. Br. Poult. Sci. 42:81–91.[ISI][Medline]

Dudas, P. L., A. R. Villalobos, G. Gocek-Sutterlin, G. Laverty, and J. L. Renfro. 2002. Regulation of transepithelial phosphate transport by PTH in chicken proximal tubule epithelium. Am. J. Physiol. Regul. Integr. Comp. Physiol. 282:139–146.

Gesellschaft für Ernährungsphysiologie. 1999. Energie- und Nährstoffbedarf landwirtschaftlicher Nutztiere. 7. Empfehlungen zur Energie- und Nährstoffversorgung der Legehennen und Masthühner (Broiler). DLG-Verlag, Frankfurt a. M., Germany.

Hempel, R., E. Strobel, and M. Rodehutscord. 2004. Inevitable phosphorus losses of laying hens. Proc. Soc. Nutr. Physiol. 13:31 (Abstr.)

Huber, K., C. Walter, B. Schröder, and G. Breves. 2002. Phosphate transport in the duodenum and jejunum of goats and its adaptation by dietary phosphate and calcium. Am. J. Physiol. Regul. Integr. Comp. Physiol. 283:R296–R302.[Abstract/Free Full Text]

Kruse-Jarres, J. D. 1979. Klinische Chemie, vol II, Spezielle klinisch-chemische Analytik. Fischer Verlag, Stuttgart, Germany.

Murer, H., I. Forster, and J. Biber. 2004. The sodium phosphate cotransporter family SLC34. Pflugers Arch.—Eur. J. Physiol. 447:763–767.[ISI][Medline]

Murer, H., H. Hernando, I. Forster, and J. Biber. 2000. Proximal tubular phosphate reabsorption: Molecular mechanisms. Physiol. Rev. 80:1373–1409.[Abstract/Free Full Text]

Quamme, G. A. 1985. Phosphate transport in intestinal brush-border membrane vesicles: Effect of pH and dietary phosphate. Am. J. Physiol. Gastrointest. Liver Physiol. 249:G168–G176.[Abstract/Free Full Text]

Radanovic, T., C. A. Wagner, H. Murer, and J. Biber. 2005. Regulation of intestinal phosphate transport I. Segmental expression and adaptation to low Pi diet of the type IIb Na+-Pi cotransporter in mouse small intestine. Am. J. Physiol. Gastrointest. Liver Physiol. 288:G496–G500.[Abstract/Free Full Text]

Renfro, J. L., and N. B. Clark. 1984. Parathyroid hormone effect on chicken renal brush-border membrane phosphate transport. Am. J. Physiol. Regul. Integr. Comp. Physiol. 247:R302–R307.[Abstract/Free Full Text]

Rodehutscord, M., and A. Dieckmann. 2005. Comparative studies with 3 wk-old chickens, turkeys, ducks, and quails on the response in phosphorus utilization to a supplementation of monobasic calcium phosphate. Poult. Sci. 84:1252–1260.[Abstract/Free Full Text]

Rodehutscord, M., F. Sanver, and R. Timmler. 2002. Comparative study on the effect of variable phosphorus intake at two different calcium levels on P excretion and P flow at the terminal ileum of laying hens. Arch. Anim. Nutr. 56:189–198.

Sarker, B. C., and U. P. S. Chaunan. 1967. A new method for determining microquantities in biological materials. Anal. Biochem. 20:155.[ISI][Medline]

Schröder, B., and G. Breves. 1996. Mechanisms of phosphate uptake into brush border membrane vesicles from goat jejunum. J. Comp. Physiol. [B] 166:230–240.[Medline]

Schröder, B., C. Walter, G. Breves, and K. Huber. 2000. Comparative studies on Na-dependent Pi transport in ovine, caprine and porcine renal cortex. J. Comp. Physiol. [B] 170:387–393.[Medline]

Stanton, T. S., R. P. Glahn, and R. F. Wideman, Jr. 1989. The effects of dietary phosphorus and parathyroid hormone (PTH) infusion rates on the avian phosphaturic response to PTH. J. Exp. Biol. 144:521–533.[Abstract/Free Full Text]

Van der Klis, J. D., H. A. J. Versteegh, P. C. M. Simons, and A. K. Kies. 1997. The efficacy of phytase in corn-soybean meal-based diets for laying hens. Poult. Sci. 76:1535–1542.[Abstract/Free Full Text]

Werner, A., S. A. Kempson, J. Biber, and H. Murer. 1994. Increase of Na/Pi-cotransport encoding mRNA in response to low Pi diet in rat kidney cortex. J. Biol. Chem. 269:6637–6639.[Abstract/Free Full Text]

Werner, A., and R. K. H. Kinne. 2001. Evolution of the Na-Pi cotransport systems. Am. J. Physiol. Regul. Integr. Comp. Physiol. 280:R301–R312.[Abstract/Free Full Text]

Wideman, R. F., Jr. 1987. Renal regulation of avian calcium and phosphorus metabolism. J. Nutr. 117:808–815.[Abstract/Free Full Text]

Wideman, R. F., Jr., J. A. Closser, W. B. Roush, and B. S. Cowen. 1985. Urolithiasis in pullets and laying hens: Role of dietary calcium and phosphorus. Poult. Sci. 64:2300–2307.[ISI][Medline]

Wideman, R. F., Jr., W. B. Roush, J. L. Satnick, R. P. Glahn, and N. O. Oldroyd. 1989. Methionine hydroxyl analog (free acid) reduces avian kidney damage and urolithiasis induced by excess dietary calcium. J. Nutr. 119:818–828.[Abstract/Free Full Text]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huber, K.
Right arrow Articles by Rodehutscord, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huber, K.
Right arrow Articles by Rodehutscord, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS