Poult. Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Poult Sci 2007. 86:202-205
© 2007 Poultry Science Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sazanov, A. A.
Right arrow Articles by Malewski, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sazanov, A. A.
Right arrow Articles by Malewski, T.

RAPID COMMUNICATION

Expression of Positional Candidates for Shell Thickness in the Chicken

A. A. Sazanov*,1, V. A. Stekol’nikova*, M. Korczak{dagger}, A. L. Sazanova*, K. Jaszczak{dagger}, G. Zieba{dagger} and T. Malewski{dagger}

* Institute of Farm Animal Genetics and Breeding, Russian Academy of Agricultural Science, Moskovskoye sh. 55A, St Petersburg, Pushkin 196601, Russia; and {dagger} Institute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrzebiec, 05–552 Wolka Kosowska, Poland

1 Corresponding author: alexei_sazanov{at}mail.ru


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Expression of 12 positional candidates for QTL affecting shell thickness at 53 wk of lay age (ST53) was investigated by real-time PCR in the distal part of chicken oviducts (uterus) with a forming eggshell. In the local chicken breed Green-legged Partridgenous, the complete cDNA CR523443 [GenBank] (ChEST985k21) was downregulated with ratio of means 0.49 (P ≤ 0.01) in the group with low ST53 (248.6 ± 16.62 µm) relative to the group with the highest ST53 (372.4 ± 2.07 µm). Expression of this gene was highly correlated (0.85, P ≤ 0.01) with shell thickness. No significant difference in expression between the 2 groups with thick (378.4 ± 3.65 µm) and thin (227.8 ± 8.99 µm) shell and no significant correlation of expression level with ST53 were detected in Rhode Island Red, which could be explained by strict selection to egg quality traits, including optimal shell thickness in this commercial layer breed. These data suggested that CR523443 [GenBank] was a candidate gene for QTL ST53 in the chicken.

Key Words: Gallus gallus • quantitative trait loci • shell thickness • gene expression profiling • real-time PCR


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Searching for candidate genes affecting quantitative traits could be a tool for MAS. Recently, a large number of genetic markers that facilitate QTL analysis has been generated and mapped in multiple experimental populations. The current availability of highly polymorphic DNA markers in many species renders possible the elaboration of well-saturated genetic maps and, consequently, genetic dissection of complex quantitative traits (Vallejo et al., 1998). Among the genetic markers that are currently used, microsatellites have been found to be abundant, evenly distributed, and highly polymorphic in all resource populations (Cheng et al., 1995).

The results of the whole genome scan for detection and localization of QTL affecting egg quality traits were described by Tuiskula-Haavisto et al. (2002). At 1% genome-wise significance level, 14 chromosomal areas affecting egg quality were found, and at 5% level, only 6 suggestive QTL were found in this study. Another whole genome scan was done in Green-legged Partridgenous (GLP), a native Polish breed maintained as a conservative flock, and a highly productive stock of Rhode Island Red (RIR; Wardecka et al., 2002, 2003). The significant effect of the genotype (GLP-GLP, RIR-RIR, and GLP-RIR) was found for 16 traits: age at sexual maturity, BW at 20 and 33 wk, feed intake at 33 wk, total individual egg production, egg weight at 53 wk, egg specific gravity at 33 wk, Haugh units at 53 wk, yolk weight at 33 wk, albumen weight at 33 and 53 wk, shell weight at 33 and 53 wk, shell thickness at 33 and 53 wk, and shell color at 33 wk (Wardecka et al., 2003).

The eggshell is a highly ordered structure resulting from the deposition of calcium carbonate concomitantly with an organic matrix upon the eggshell membranes. Mineralization takes place in an acellular uterine fluid, which contains the ionic and matrix precursors of the eggshell (Gautron et al., 2001). It forms in the uterine (shell gland) region of the oviduct in an acellular milieu that is supersaturated with respect to Ca and bicarbonate and which contains a variety of proteins that vary in concentrations during the sequential process of shell formation (Gautron et al., 2001). Formation of eggshell microstructure underlay complex regulations imposed by the resident egg (Lavelin et al., 2000). Significant age and environment effects were found for shell thickness (Edmond et al., 2005).

Shell thickness at 53 wk of lay age (ST53) was mapped on Gga4 very close to MCW0114 (Wardecka et al., 2002, 2003). Nine chicken genomic bacterial artificial chromosome clones containing the MCW0114 were fluorescence in situ hybridization-mapped to GGA4q11-12 (Sazanov et al., 2005). Here, expression profiling of 12 positional candidates for QTL affecting ST53 investigated by real-time PCR in the lower part of chicken oviducts with a forming eggshell in RIR and GLP is reported.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Twenty expressed sequence tags (Table 1Go) were selected from the Gga4 region 16,137,294 to 17,826,844 (Gga4q11-12, MCW0114 surrounding area) in recently released draft genome sequence of the chicken (http://www.ncbi.nlm.nih.gov/genome//guide/chicken). Design of primers for PCR was done using the Primer Input 3 software (http://frodo.wi.mit.edu). Primer sequences are given in Table 1Go. Five birds with high ST53 (STH) and 5 birds with low ST53 (STL) from RIR and GLP were used for expression quantification. The ST53 means and SD were as follows: 378.4 ± 3.65 µm (RIR STH), 227.8 ± 8.99 µm (RIR STL), 372.4 ± 2.07 µm (GLP STH), and 248.6 ± 16.62 µm (GLP STL). The ST53 measurement was done on 3 consecutive eggs from each bird 5 d before isolation of oviducts. The tissue samples were isolated from the distal part of chicken oviducts (uterus) with forming eggshell at 53 wk of age. Fifty to 100 mg of tissue per bird was used to isolate total RNA using Trizol reagent (Sigma-Aldrich Corp., St Louis, MO) according to instructions of the manufacturer. First-strand cDNA for real-time-PCR of candidate genes was synthesized using Enhanced Avian Reverse Transcription PCR Kit (Sigma-Aldrich Corp.) according to the manufacturer’s directions. The PCR amplification mix consisted of 2 µL of reverse transcription product, 10 µL of SYBR Green JumpStart Taq ReadyMix Capillary Formulation (Sigma-Aldrich Corp.), and 2 µL of 5 mM each primer in a final volume of 20 µL. The PCR reaction conditions consisted of an initial 5-min hold at 95°C, 40 cycles of 95°C for 10 s, 55°C for 10 s, and 72°C for 15 s in a LightCycler (Roche, Basel, Switzerland). A melting curve analysis was performed from 65 to 95°C. The chicken GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene (accession no. NM_204305 [GenBank] ; GAPDHfw, CCTCTCTGGCAAAGTCCAAG; GAPDHrv, CATCTGC CCATTTGATGTTG) was used as a reference gene (Li et al., 2005). The 2{Delta}{Delta}Ct method (Livak and Schmittgen, 2001) for the calculation of the relative ratio was used. Differences between the mean of candidate expressed sequence tags quantities in oviducts of STH and STL groups were tested for by a 2-tailed t-test. All calculations were performed using Excel 2003 (Microsoft Corp., Seattle, WA).


View this table:
[in this window]
[in a new window]

 
Table 1. Positional candidate genes target sequences used for expression profiling
 

    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The conventional PCR with specificity for 20 target sequences primers (Table 1Go) using cDNA prepared from the oviduct tissue samples as templates resulted in getting 12 fragments of expected sizes. The mRNA expression of these 12 target sequences was measured by real-time quantitative reverse transcription PCR (Table 2Go). No significant difference in expression between STH and STL and no significant correlation of expression level with ST53 were detected in RIR (Table 2Go). Thus, genetic heterogeneity of factors affecting shell thickness is expected to be less in RIR than in the conserved GLP breed, which has been kept without selection for many generations. In GLP, the CR523443 [GenBank] was downregulated with ratio of means 0.49 (P ≤ 0.01) in STL relative to STH (Table 2Go). Expression of this gene was significantly correlated (0.85, P ≤ 0.01) with shell thickness (Table 2Go). These data suggested CR523443 [GenBank] is a potential candidate gene for QTL ST53 in chicken.


View this table:
[in this window]
[in a new window]

 
Table 2. Expression profiling of candidate EST and correlation between shell thickness (ST) at 53 wk of age and expression level of positional candidates1
 
The 2,102 bp sequence CR523443 [GenBank] (Gallus gallus finished cDNA, clone ChEST985k21) primarily was found in mRNA extracted from adult muscle and then was detected in brain, cartilage, female genital, and head (http://www.ncbi.nlm.nih.gov/UniGene). A BLAST search did not show significant homology to other vertebrate sequences.

Relatively little is known about the genes that are involved in the formation of eggshell in birds. In the present study, real-time PCR was used to identify genes affecting this trait based on their position close to the microsatellite loci linked to the QTL. Positional approach was successfully applied for genetic dissection and searching for candidate genes for QTL in different species (Glazier et al., 2002). In livestock, well-approved candidate gene DGAT1 (diacylglycerol O-acyltransferase 1) was found for milk fat content (Grisart et al., 2002, 2004; Furbass et al., 2006). Optimization of shell thickness has economical importance because it can help to reduce transportation losses. Finding the candidate gene for ST53 provides a tool for searching for QTL, which could be applied for MAS.


    ACKNOWLEDGMENTS
 
The current research was supported by grant from the Russian Federal Agency on Science and Innovations (contract no. 02.438.11.7014 [EC] ) and the Russian Foundation for Basic Researches (06-04-48031-a).

Received for publication May 31, 2006. Accepted for publication July 26, 2006.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Cheng, H. H., I. Levin, R. L. Vallejo, H. Khatib, J. B. Dodgson, L. B. Crittenden, and J. Hillel. 1995. Development of a genetic map of the chicken with markers of high utility. Poult. Sci. 74:1855–1874.[Web of Science][Medline]

Edmond, A., L. A. King, S. E. Solomon, and M. M. Bain. 2005. Effect of environmental enrichment during the rearing phase on subsequent eggshell quality in broiler breeders. Br. Poult. Sci. 46:182–189.[Web of Science][Medline]

Furbass, R., A. Winter, R. Fries, and C. Kuhn. 2006. Alleles of the bovine DGAT1 variable number of tandem repeat associated with a milk fat QTL at chromosome 14 can stimulate gene expression. Physiol. Genomics 25:116–120.[Abstract/Free Full Text]

Gautron, J., M. T. Hincke, M. Panheleux, J. M. Garcia-Ruiz, T. Boldicke, and Y. Nys. 2001. Ovotransferrin is a matrix protein of the hen eggshell membranes and basal calcified layer. Connect. Tissue Res. 42:255–267.[Web of Science][Medline]

Glazier, A. M., J. H. Nadeau, and T. J. Aitman. 2002. Finding genes that underlie complex traits. Science 298:2345–2349.[Abstract/Free Full Text]

Grisart, B., W. Coppieters, F. Farnir, L. Karim, C. Ford, P. Berzi, N. Cambisano, M. Mni, S. Reid, P. Simon, R. Spelman, M. Georges, and R. Snell. 2002. Positional candidate cloning of a QTL in dairy cattle: Identification of a missense mutation in the bovine DGAT1 gene with major effect on milk yield and composition. Genome Res. 12:222–231.[Abstract/Free Full Text]

Grisart, B., F. Farnir, L. Karim, N. Cambisano, J. J. Kim, A. Kvasz, M. Mni, P. Simon, J. M. Frere, W. Coppieters, and M. Georges. 2004. Genetic and functional confirmation of the causality of the DGAT1 K232A quantitative trait nucleotide in affecting milk yield and composition. Proc. Natl. Acad. Sci. USA 101:2398–2403.[Abstract/Free Full Text]

Lavelin, I., N. Meiri, and M. Pines. 2000. New insight in eggshell formation. Poult. Sci. 79:1014–1017.[Abstract/Free Full Text]

Li, Y. P., D. D. Bang, K. J. Handberg, P. H. Jorgensen, and M. F. Zhang. 2005. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus. Vet. Microbiol. 110:155–165.[Web of Science][Medline]

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2{Delta}{Delta}Ct method. Methods 25:402–408.[Web of Science][Medline]

Sazanov, A. A., M. N. Romanov, B. Wardecka, A. L. Sazanova, M. Korczak, V. A. Stekol’nikova, A. A. Kozyreva, A. F. Smirnov, J. B. Dodgson, and K. Jaszczak. 2005. Chromosomal localization of fifteen large insert BAC clones containing three microsatellites on chicken chromosome 4 (GGA4) which refine its centromere position. Anim. Genet. 36:161–163.[Web of Science][Medline]

Tuiskula-Haavisto, M., M. Honkatukia, J. Vilkki, D. J. de Koning, N. F. Schulman, and A. Maki-Tanila. 2002. Mapping of quantitative trait loci affecting quality and production traits in egg layers. Poult. Sci. 81:919–927.[Abstract/Free Full Text]

Vallejo, R. L., L. D. Bacon, H. C. Liu, R. L. Witter, M. A. M. Groenen, J. Hillel, and H. H. Cheng. 1998. Genetic mapping of quantitative trait loci affecting susceptibility to Marek’s disease virus induced tumors in F2 intercross chickens. Genetics 148:349–360.[Abstract/Free Full Text]

Wardecka, B., R. Olszewski, K. Jaszczak, G. Zieba, and M. Pierzchala. 2003. Preliminary mapping of QTLs affecting egg quality on chromosomes 1–5 in chickens. Czech J. Anim. Sci. 48:97–105.

Wardecka, B., R. Olszewski, K. Jaszczak, G. Zieba, M. Pierzchala, and K. Wicinska. 2002. Relationship between microsatellite marker alleles on chromosomes 1–5 originating from the Rhode Island Red and Green-legged Partrigenous breeds and egg production and quality traits in F(2) mapping population. J. Appl. Genet. 43:319–329.[Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sazanov, A. A.
Right arrow Articles by Malewski, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sazanov, A. A.
Right arrow Articles by Malewski, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS