| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY |
,||,1
* Department of Biological Sciences, University of Calgary, Calgary T2N 4N1, Alberta, Canada; Alberta Agriculture and Food, 97 East Lake Ramp NE, Airdrie T6A 2B4, Alberta, Canada; Department of Microbiology and Infectious Diseases, University of Calgary, Calgary T2N 4N1, Alberta, Canada; Alberta Agriculture and Food, O. S. Longman Building, 6909-116 Street, Edmonton T6H 4P2, Alberta, Canada; and || Department of Biochemistry and Molecular Biology, University of Calgary, Calgary T2N 4N1, Alberta, Canada
1 Corresponding author: awhi{at}ucalgary.ca
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
agfD reference strain. The type of egg belt was the most important factor influencing Salmonella colonization and persistence. The vinyl belt, with the least surface area available for colonization, had the fewest Salmonella remaining after washing and disinfection, whereas the hemp-plastic belt, with the greatest surface area, had the most Salmonella remaining. Real-time gene expression indicated that the rdar morphotype was involved in colonizing the egg belt pieces; however, it was not essential for persistence. In addition, rdar-positive and rdar-negative strains were equally similarly to disinfection on the egg belt pieces. The results indicate that Salmonella can persist on a variety of egg belts by mechanisms other than the rdar morphotype, and that using egg conveyer belts with reduced surface area for bacterial colonization can lessen contamination problems.
Key Words: thin aggregative fimbria • curli • rdar morphotype • persistence • egg conveyor belt
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Salmonella spp. have strong persistence characteristics when compared with other gram-negative bacteria, such as Escherichia coli (Winfield and Groisman, 2003). The rdar morphotype is one physiological adaptation conserved in Salmonella (White and Surette, 2006) that occurs in response to environmental stresses, such as low osmolarity and nutrient limitation (Gerstel and Romling, 2001; Weber et al., 2006). The rdar morphotype colonies are red, dry, and rough when grown on media containing Congo red, have elaborate surface patterns, and can be removed intact from the agar surface (Romling et al., 1998). Cells aggregate within the colony through formation of an extracellular matrix in which thin aggregative fimbriae (Tafi; curli), cellulose (Romling et al., 2000; Zogaj et al., 2001; Solano et al., 2002), and other polysaccharides (Gibson et al., 2006) mediate aggregation between cells. The primary controller of the rdar morphotype is the transcriptional regulatory protein AgfD (CsgD), which activates expression of the Tafi structural genes (agfBAC) and production of cellulose (Zogaj et al., 2001; White and Surette, 2006). The presence of an extracellular matrix enhances the resistance of cells to desiccation (Gibson et al., 2006; White et al., 2006) and resistance to antimicrobial agents such as sodium hypochlorite (Solano et al., 2002; Scher et al., 2005; White et al., 2006), hydrogen peroxide, and acid (Anriany et al., 2001; Scher et al., 2005). Therefore, it is hypothesized that the rdar morphotype can contribute to the environmental persistence of Salmonella.
Under the "Start Clean-Stay Clean" On-Farm Food Safety Program currently being implemented in the province of Alberta, Canada, layer flocks are monitored for SE and Salmonella enterica serovar Typhimurium (ST) strain DT 104 by environmental sampling. Alberta Agriculture and Food staff conduct environmental sampling investigations when positive tests are obtained and when normal cleaning and disinfection fails to restore a negative Salmonella status to a positive farm. In 2004 to 2005, one commercial cage layer farm had persistent and recurring SE phage type 8 infections in the laying barn despite repeated disinfection of buildings and equipment. Agriculture and Food staff determined that the egg conveyer belt was the source of the contaminating SE strain. Past research has shown that egg conveyer belt samples are more likely to be contaminated with Salmonella than hen fecal samples (Poppe et al., 1991). Egg belts are often exposed to Salmonella and represent a potential surface for adherence and persistence; furthermore, in many battery cage setups, belts are not easily accessible for complete cleaning and disinfection. This study was performed to test 5 different types of egg conveyer belts made of vinyl, nylon, hemp, or plastic for their ability to resist colonization by Salmonella spp. In addition, we wanted to determine whether the rdar morphotype contributed to colonization and investigate the efficacy of commonly used disinfectants for eradication of Salmonella on the egg belt pieces.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
agfD mutant strain (White et al., 2006) were used as the rdar-positive and rdar-negative reference strains, respectively. Strains were routinely grown in Miller’s Luria-Bertani (LB) broth (1% salt), supplemented with 50 µg/mL of kanamycin, if necessary, for 18 to 20 h at 37°C with agitation before performing additional experiments. For growth of cells on agar, 1 µL of culture was spotted onto solid 1% tryptone (T) media (pH 7.2) containing 1.5% Difco agar and incubated at 28°C for 2 to 7 d. To visualize the production of cellulose, cells were grown on T agar containing 200 µg/mL of Calcofluor White (fluorescent brightener 28; Sigma-Ald-rich Canada, Oakville, Ontario, Canada). Colony pictures were taken with a Kodak Image Station 2000 mm camera system (Pierce, Rockford, IL).
Egg Belt Colonization Experiments
Experiments were designed to simulate contamination of the belts during production, followed by disinfection and drying, which would normally occur before a facility is repopulated with laying hens. Four belt types were named based on their composition: vinyl, plastic, nylon, and hemp-plastic. The fifth belt, named the farmer’s belt, was made of hemp and was obtained from the contaminated layer facility investigated by Agriculture and Food staff. The vinyl belt was a single piece of vinyl, whereas the rest of the belts were of woven construction.
Following the experimental model of Ryu and Beuchat (2005), each belt was cut into 1 cm2 pieces and sterilized by autoclaving (vinyl, nylon, and farmer’s belt) or immersed in 70% ethanol for 2 h and dried in a biosafety cabinet (plastic and hemp-plastic belts). For inoculation, cells from 200-mL overnight cultures were sedimented by centrifugation (4,500 x g, 10 min), resuspended in 0.5% T to a concentration of 
2 x 1010 cells per mL (A600 of 20) and spotted in 50-µL aliquots (109 cells) onto the egg belt pieces. Each group of 15 belt pieces, from a total of 45 pieces of each belt type for each Salmonella strain, was stored as sets of 5 in 3 Petri plates and incubated at 28°C for 7 d before processing or treatment. For treatment, 20 mL of water (pH 7) or 0.1% Virkon S (Antec International, Suffolk, UK) in water was added to each Petri dish and mixed slowly for 10 min on a linear shaker. Water or Virkon solution was removed by pipetting and replaced with 20 mL of water (pH 7). After 10 min, water was removed and belt pieces were incubated at 28°C for an additional 7 d. For processing, pieces were transferred to sterile 16 x 125 mm borosilicate culture tubes containing 1 mL of PBS (pH 7.4) and cells were rehydrated for 1 h. After vortexing for 30 s, 0.5 mL of the cell mixture was removed and mixed in a tissue homogenizer for 20 s. Each sample was serially diluted in triplicate and plated in duplicate in 5-µL drops onto LB or T agar and incubated at 28°C overnight. Spots with 5 to 50 colonies were counted and used to determine the number of viable cells (cfu).
Statistical Analysis
Egg belt colonization and persistence data were evaluated with nonparametric tests because the assumptions of parametric tests were violated. Therefore, data were described by using medians, and even after logarithmic transformation, interquartile ranges and were analyzed in a log10 format. Data from each Salmonella strain were analyzed separately. For each belt type, differences were calculated between the median log10 cfu from the initial colonization group and log10 cfu values for each belt piece in the groups treated with water or Virkon. Differences were also calculated between the median log10 cfu of the water-treated group (also reflecting differences in initial colonization) and the log10 cfu of each belt piece in the Virkon-treated group. The log10 cfu differences were compared across belt types by using a Kruskal-Wallis test followed by a series of Mann-Whitney U-tests. For each strain, 30 multiple comparisons were performed for each outcome; therefore, a Bonferroni correction was used and statistical significance was noted if P < 0.0017 (=0.05/30). Analyses were conducted with a commercial statistical software package (SPSS v. 15.0.0 for Windows, SPSS Inc., Chicago, IL).
Environmental Scanning Electron Microscopy
Glass coverslips (18 x 18 mm) were mounted onto environmental scanning electron microscopy (ESEM) stubs as described by Sibley et al. (2006) with glue containing colloidal graphite; following drying at room temperature (RT), cover slips were sputter-coated with 5 nm of gold by using a Hummer sputter coater (Anatech USA, Hayward, CA). Inoculated egg belts were mounted onto the coverslips with the same glue, making sure to connect the glue from the egg belt to the bottom of the stub to prevent charging. The egg belt pieces were coated with an additional 2 nm of gold. Samples were viewed with a Philips XL30 Environmental Scanning Electron Microscope at 3 to 4 Torr, with an accelerating voltage of 15 kV.
Recombinant DNA Techniques and Construction of Luciferase Reporters
Deoxyribonucleic acid containing agfD and agfB promoter regions was PCR amplified from SE 11852 by using primers agfD1 and agfD2 (White et al., 2006), sequentially digested with XhoI and BamHI (Invitrogen Canada Inc., Burlington, Ontario, Canada), and ligated into pCS26-Pac (XhoI-BamHI) or pU220 (BamHI-XhoI) reporter vectors containing the luxCDABE operon from Photorhabdus luminescens (Bjarnason et al., 2003). Deoxyribonucleic acid sequencing was performed by the University of Calgary Core DNA services (http://dnaservices.myweb.med.u-calgary.ca/) by using primers pZE05 and pZE06 (Bjarnason et al., 2003). The ST 14028 agfB and synthetic RpoS (
S)-responsive luciferase reporters have been described previously (White et al., 2006). The control 70 promoter (sig70-7) has the sequence 5'-CTCGAGAATAATTCTTG ATATTTATGCTTCCGGCTCGTATTTTACGTGCAATT GGATCC-3' and was cloned into the XhoI-BamHI sites of pCS26 as described previously (Kim and Surette, 2006). This was one of several control 70-dependent promoters selected from a library constructed with the above sequence with 4 degenerate positions in the promoter (underlined; K. Pabbaraju and M. G. Surette, University of Calgary, Calgary, Alberta, Canada, unpublished data). Plasmids were transformed into Salmonella strains by electroporation (Bio-Rad Laboratories Inc., Hercules, CA).
RT Gene Expression-Bioluminescence Assays
For bioluminescence assays in culture, overnight cultures were diluted 1 in 600 in T broth supplemented with 50 µg/mL Kan to a final volume of 150 µL in 96-well, clear-bottomed black plates (9520 Costar, Corning Inc., Corning, NY). The culture in each well was overlaid with 50 µL of mineral oil prior to starting the assays. Cultures were assayed for luminescence (0.1 s) and absorbance (620 nm, 0.1 s) every 30 min during growth at 28°C with agitation in a Wallac Victor instrument (PerkinElmer Life Sciences, Boston, MA).
For bioluminescence assays on egg belts, ST 14028 and SE 11852 reporter strains were resuspended in 0.5% T to a concentration of 2 x 1010 cells per mL and serially diluted 1,000-fold. Aliquots of 50 µL of cells, at each density, were inoculated onto egg belt pieces in 24-well, clear-bottomed black plates (Black Visiplate-24 TC, Perkin Elmer). Luminescence (1 s) was measured continuously (8 min between reads) at room temperature in a Wallac 1450 Microbeta Trilux instrument (PerkinElmer Life Sciences) until the inocula had dried onto the belts. The agfD reporter strains were included as controls. Each reporter strain was tested in duplicate at each cell density, and experiments were repeated twice.
Exposure of rdar Morphotype Colonies to Disinfectants
Colonies were removed from the T agar surface and stored in 24-well tissue culture plates (1 colony per well) at 28°C for 7 d. Colonies were hydrated in 500 µL of PBS for 1 h at RT, and 100 µL of disinfectant solution (to a final concentration of 0.025 to 1.0%) or PBS was added and mixed continuously by using a rotating microtube mixer for 10 min at RT. Cells and colony materials were centrifuged (7,000 x g, 2 min) and the supernatant was removed. A 500-µL quantity of fresh PBS was added, and colony slurries were mixed in a tissue homogenizer until uniform turbidity was reached (20 s). To determine the number of colony-forming units remaining in each sample, cell mixtures were serially diluted in triplicate, plated in duplicate in 5-µL drops onto LB agar, incubated at 28°C overnight, and the colony-forming units enumerated.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Controls for cell survival confirmed that the drop in cfu was due to cell death after incubation at 28°C for 7 d and not from an inability to dislodge the cells by vortexing (data not shown). The water wash treatment tested the persistence of Salmonella on the different belt types (Figure 1); in each case, the drop in Salmonella cfu caused by washing was statistically significant from the initial colonization values. The vinyl belt pieces had a significant drop in Salmonella cfu (>3 log10 units) compared to the other belt types, whereas the farmer’s belt had the smallest drop in cfu, of 1 log10 unit, which was statistically different from all other belt types except the hemp-plastic belt. Disinfection with Virkon, a peroxygen-based disinfectant (McDonnell and Russell, 1999), was effective on all belt types, with significant cfu reductions compared with the water-treated samples (Figure 1). The vinyl, nylon, and farmer’s belts all had large reductions in cfu after treatment with Virkon; for the vinyl belt, counts for 12 of 15 pieces were below the limits of detection. The hemp-plastic belt retained significantly more cells than the nylon, vinyl, and farmers belts for ST 14028 and all other belts for SE 11852. Results for the 2 S. enterica strains mirrored each other for all treatment groups. Overall, the vinyl belt was the most resistant to Salmonella colonization and persistence, whereas the hemp-plastic belt was the least resistant.
|
). The hemp-plastic belt was estimated to have the greatest surface area because of the stringy nature of the hemp fibers. The nylon belt was intermediate in surface area, and the farmer’s belt was similar to the hemp-plastic belt (data not shown). Both S. enterica strains formed biofilms on the belt surfaces after inoculation (Figure 2). The lack of scattered cells or clumps of cells indicated that the bacteria were adhering to each other as well as to the belt materials. Cells flattened out into a layer on top of both the vinyl and plastic belts, and cells could be clearly differentiated from the belt surface (Figure 2). In contrast, it was hard to differentiate between the fibers and cells on the hemp-plastic belt (Figure 2). Raised areas of cells were observed on the vinyl belt (Figure 2), although it was not determined if these areas represented differentiated biofilm structures or artifacts caused by the drying process.
|
), had the ability to bind Calcofluor, and could be lifted off the agar surface intact (data not shown), similar to the rdar-positive ST 14028 strain (Romling et al., 1998; Zogaj et al., 2001). This indicated that SE 11852 was capable of producing both Tafi and cellulose. However, SE 11852 colonies were noticeably smaller than ST 14028 colonies (Figure 3A). To confirm that SE 11852 was positive for the rdar morphotype, expression of an agfB promoter::lux reporter was measured during growth in liquid media (Figure 3B). Maximal agfB gene expression for SE 11852 occurred after 30 h of growth, similar to ST 14028; however, the maximum expression was only half that of ST 14028 (Figure 3B). The drop in SE 11852 agfB expression was attributed to a change in the promoter region of agfD (data not shown; see White and Surette, 2006). When SE 11852 and ST 14028 expression profiles were normalized to account for magnitude differences, the profiles were nearly identical (data not shown).
|
70) or RpoS(38) activity was monitored. Maximal expression of the 70 and RpoS-responsive reporters for both S. enterica strains increased as increasing numbers of cells were used (Figure 4A). In contrast, agfB expression reached the highest level at the 108 cfu inoculum, followed by the 107 (ST 14028) or 109 cfu (SE 11852) inocula (Figure 4A). Despite differences in the magnitude of expression, temporal expression profiles showed clear agfB activation at each of the 109, 108, and 107 cfu inocula for both ST 14028 (Figure 4B) and SE 11852 (data not shown). In each experiment, there was an increase in sigma factor activity over time, followed by a time lag prior to agfB expression as the media evaporated to dryness (Figure 4B). Overall, these results provide evidence that the rdar morphotype was expressed by the S. enterica strains under the conditions of our experiment. Similar results were achieved with the vinyl egg belt. For the nylon, hemp-plastic, and farmer’s belts, the inoculum was absorbed into the belt pieces, which partially blocked light emissions and led to inconsistent results (data not shown).
|
agfD strain unable to produce Tafi and additional extracellular components (Romling et al., 1998; Zogaj et al., 2001; White et al., 2006). The agfD cells were recovered at numbers similar to wild-type ST 14028 after initial colonization (data not shown). The agfD cells on the vinyl and hemp-plastic belts displayed a more patchy covering of the egg belt pieces than was observed with the wild-type strains (Figure 5A). High-magnification ESEM pictures revealed that the agfD strain was surrounded by abundant extracellular material but lacked the fibrous network seen between cells of the parent strain (Figure 5B). Despite the patchy colonization observed, the agfD mutant was only marginally easier to wash off the egg belt pieces than the ST 14028 and SE 11852 strains (data not shown). In addition, the agfD and ST 14028 strains were equally susceptible to Virkon treatment on the nylon and hemp-plastic egg belts (Figure 5C). Survival of agfD was reduced by 2.5 log10 units on the plastic egg belt and by 1 log10 unit on the farmer’s belt as compared with ST 14028 (Figure 5C), demonstrating that the type of egg belt material can influence the efficiency of disinfection.
|
agfD strains had different inherent resistances, we examined Salmonella survival when exposed to 3 different disinfectants commonly used in poultry barns, Virkon, chlorophenol (One-Stroke Environ Pro-Ag Products Ltd., Winnipeg, Manitoba, Canada), and Quat-O-Germ (W. E. Greer Ltd., Edmonton, Alberta, Canada). Treatments with a range of disinfectant concentrations were tested on colonies transferred to plastic and incubated at 28°C. After 7 d, there were 10-fold fewer viable agfD cells as compared with the parent strain (Figure 6A, 6B, and 6C). Upon exposure to 0.0625 and 0.125% Virkon, approximately 1 log10 unit of agfD cells was killed, whereas the ST 14028 cell numbers did not change appreciably (Figure 6A). When Virkon was increased to 0.25%, a greater than 5 log10-unit difference in cfu was observed; agfD cfu counts dropped below the limits of detection, whereas 107 ST 14028 cells were viable (Figure 6A). Similar results were obtained for SE 11852 (data not shown). Differences between the ST 14028 and agfD strains were also observed with the Quat-O-Germ and chlorophenol disinfectants; agfD viability was reduced by at least 5 orders of magnitude when colonies were treated with 0.25% Quat-O-Germ (Figure 6B) or 0.1% chlorophenol (Figure 6C). Overall, chlorophenol appeared to be the most effective disinfectant, with complete killing of both strains at 0.2% (Figure 6C), whereas Quat-O-Germ was the least effective.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In selecting an egg belt, the commercial farmer must consider several factors, including egg belt cost, durability, and ability to resist contamination. The vinyl belt appears to be the best belt for reducing Salmonella persistence. A confounding issue in the past was the lack of durability and the increased cost of vinyl belts compared with belts made of woven material. However, considering that there is a recent elevation in the importance of SE-and ST-free laying barns, and the costs associated with continual environmental contamination, the utilization of smoother-surfaced egg belts may warrant a recommendation by Egg Marketing jurisdictions in Canada.
Real-time gene expression analysis indicated that the rdar morphotype was involved in the colonization of egg belts. For both ST 14028 and SE 11852, agfB (Tafi) expression was detected as the inocula dried onto the belt pieces. The time lag prior to agfB activation was interpreted to represent a period of cell growth corresponding to an increase in 70 and S activity. It was unexpected that both sigma factors would be active under these drying conditions, because they compete for binding to the RNA polymerase holoenzyme and each drives expression of a distinct subset of genes (Hengge-Aronis, 2002). However, the interplay between 70 and S under environmental conditions is not well understood. The agfB expression was assumed to be activated in response to nutrient limitation, as reported previously (Gerstel and Romling, 2001), and possibly in response to desiccation (White et al., 2006). As confirmation of these results, the presence of an extensive Tafi and cellulose network was observed between individual cells on the egg belt pieces.
Despite the involvement in colonization, the rdar morphotype did not play a big role in persistence under the conditions of our experiment. Cells of the agfD strain were not more easily dislodged from egg belts than ST 14028 or SE 11852. This finding was surprising, because agfD strains are known to have reduced cell-cell aggregation (Romling et al., 1998; Romling et al., 2000) and colonization of abiotic surfaces (Uhlich et al., 2006). It is possible that a longer incubation period for Salmonella on the egg belts would have resulted in a greater difference between strains, because the rdar morphotype allows cells to survive in the environment for months without exogenous nutrients (White et al., 2006). The agfD strain was also expected to be more susceptible to disinfection (Scher et al., 2005; Uhlich et al., 2006; White et al., 2006), yet this was true on only 2 of the 5 belt types. Together, the washing and disinfection results seemed to contradict the RT expression data. One complicating factor was that the highest agfB expression for ST 14028 and SE 11852 was recorded when 108 cfu were inoculated onto the belt pieces, not at 109 cfu as tested in our experiments. We repeated the egg belt experiment by using an inoculum of 108 cfu, but similar results were obtained (data not shown). Although it is possible that the rdar morphotype may enhance Salmonella survival in other environments within the barn, such as feces, cage dust, feed hoppers, and soil (Garber et al., 2003; Wales et al., 2006a,b), biofilm formation and colonization is a complex process (Austin et al., 1998; Romling et al., 2003; Barak et al., 2005; Latasa et al., 2005; Solomon et al., 2005; Lapidot et al., 2006).
Treatment with Virkon, a disinfectant commonly used in the agricultural industry, was effective at reducing Salmonella contamination on colonized egg belts. Complete disinfection was not achieved because Virkon was used at 0.1%, 10 times below the concentration recommended by the manufacturer. Killing of all strains was increased on the vinyl and nylon egg belt pieces, proving again that the type of surface can influence Salmonella persistence. The ST 14028 and agfD strains had differential susceptibilities at 0.25% Virkon when grown as colonies, with the agfD strain being 5 log10 units more susceptible. This inherent strain difference was also observed with Quat-O-Germ, a quaternary ammonium sanitizer, and chlorophenol, a phenol-based disinfectant. Virkon acts by oxidation of proteins and other cytoplasmic components, whereas Quat-O-Germ and chlorophenol cause damage to the bacterial inner membrane primarily (McDonnell and Russell, 1999). The different susceptibilities observed could reflect a difference in Salmonella grown on agar vs. egg belts. It is possible that agfD cells on egg belts were able to produce cellulose and other poly-saccharides in an AgfD-independent manner, as has been reported for E. coli (Da Re and Ghigo, 2006). The order of efficacy of the 3 disinfectants tested on Salmonella colonies was chlorophenol > Virkon > Quat-O-Germ. Based on the survival results, treatment of egg conveyor belts with disinfectants at the manufacturer’s recommended concentrations should eliminate Salmonella contamination, although the presence of additional organic matter, such as feather dust, and particularly egg yolk from broken and cracked eggs, could interfere with the efficacy of disinfection (Gradel et al., 2004; Wales et al., 2006a).
It is difficult to recreate or evaluate "real-world" contamination situations experimentally, such as SE infections in caged layer farms, because of the myriad factors that affect contamination, disinfection, and persistence. Garber et al. (2003) established that one potential risk factor on SE-positive farms was the presence of mice harboring SE infections. Our experiments were based on an example in which the egg conveyor belt was a reservoir for persistent SE infections. The results demonstrate that the type of belt material used can influence Salmonella persistence. The vinyl belt offered no more than a smooth surface for the organisms to grow, hence the relative ease of biofilm removal compared with the multiplied surface area for growth on the woven belts. With woven belts, greater dependence on the use of detergents and disinfectants may be required to reduce Salmonella numbers, along with ensuring the presence of additional physical conditions, such as elevated temperatures and low pH, to enhance their efficacy. Further research should be performed to test the efficacy of other disinfectants, such as formaldehyde or glutaraldehyde (Gradel et al., 2004), as well as to examine the role of egg contents in environmental biofilm formation on egg conveyor belts. Understanding Salmonella colonization and persistence in these and other natural environments will undoubtedly help to combat the spread of these important pathogens and eventually lead to reduced Salmonella-associated human illness.
|
ACKNOWLEDGMENTS |
|---|
Received for publication March 19, 2007. Accepted for publication July 4, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Austin, J. W., G. Sanders, W. W. Kay, and S. K. Collinson. 1998. Thin aggregative fimbriae enhance Salmonella enteritidis biofilm formation. FEMS Microbiol. Lett. 162:295–301.[CrossRef][ISI][Medline]
Barak, J. D., L. Gorski, P. Naraghi-Arani, and A. O. Charkowski. 2005. Salmonella enterica virulence genes are required for bacterial attachment to plant tissue. Appl. Environ. Microbiol. 71:5685–5691.
Bjarnason, J., C. M. Southward, and M. G. Surette. 2003. Genomic profiling of iron-responsive genes in Salmonella enterica serovar Typhimurium by high-throughput screening of a random promoter library. J. Bacteriol. 185:4973–4982.
Burnett, S. L., and L. R. Beuchat. 2000. Human pathogens associated with raw produce and unpasteurized juices, and difficulties in decontamination. J. Ind. Microbiol. Biotechnol. 25:281–287.[CrossRef][ISI][Medline]
Cook, K. A., T. E. Dobbs, W. G. Hlady, J. G. Wells, T. J. Barrett, N. D. Puhr, G. A. Lancette, D. W. Bodager, B. L. Toth, C. A. Genese, A. K. Highsmith, K. E. Pilot, L. Finelli, and D. L. Swerdlow. 1998. Outbreak of Salmonella serotype Hartford infections associated with unpasteurized orange juice. J. Am. Med. Assoc. 280:1504–1509.
Da Re, S., and J. M. Ghigo. 2006. A CsgD-independent pathway for cellulose production and biofilm formation in Escherichia coli. J. Bacteriol. 188:3073–3087.
De Buck, J., F. Van Immerseel, F. Haesebrouck, and R. Ducatelle. 2004. Colonization of the chicken reproductive tract and egg contamination by Salmonella. J. Appl. Microbiol. 97:233–245.[CrossRef][Medline]
Garber, L., M. Smeltzer, P. Fedorka-Cray, S. Ladely, and K. Ferris. 2003. Salmonella enterica serotype Enteritidis in table egg layer house environments and in mice in U.S. layer houses and associated risk factors. Avian Dis. 47:134–142.[CrossRef][ISI][Medline]
Gerstel, U., and U. Romling. 2001. Oxygen tension and nutrient starvation are major signals that regulate agfD promoter activity and expression of the multicellular morphotype in Salmonella typhimurium. Environ. Microbiol. 3:638–648.[CrossRef][Medline]
Gibson, D. L., A. P. White, S. D. Snyder, S. Martin, C. Heiss, P. Azadi, M. Surette, and W. W. Kay. 2006. Salmonella produces an O-antigen capsule regulated by AgfD and important for environmental persistence. J. Bacteriol. 188:7722–7730.
Gradel, K. O., A. R. Sayers, and R. H. Davies. 2004. Surface disinfection tests with Salmonella and a putative indicator bacterium, mimicking worst-case scenarios in poultry houses. Poult. Sci. 83:1636–1643.
Hengge-Aronis, R. 2002. Stationary phase gene regulation: What makes an Escherichia coli promoter S-selective? Curr. Opin. Microbiol. 5:591–595.[CrossRef]
Kim, W., and M. G. Surette. 2006. Coordinated regulation of two independent cell-cell signaling systems and swarmer differentiation in Salmonella enterica serovar Typhimurium. J. Bacteriol. 188:431–440.
Lapidot, A., U. Romling, and S. Yaron. 2006. Biofilm formation and the survival of Salmonella Typhimurium on parsley. Int. J. Food Microbiol. 109:229–233.[CrossRef][ISI][Medline]
Latasa, C., A. Roux, A. Toledo-Arana, J. Ghigo, C. Gamazo, J. R. Penadés, and I. Lasa. 2005. BapA, a large secreted protein required for biofilm formation and host colonization of Salmonella enterica serovar Enteritidis. Mol. Microbiol. 58:1522–1539.
Lynch, M., J. Painter, R. Woodruff, and C. Braden. 2006. Surveillance for foodborne-disease outbreaks—United States, 1998–2002. MMWR Surveill. Summ. 55:1–42.[Medline]
McDonnell, G., and A. D. Russell. 1999. Antiseptics and disinfectants: Activity, action, and resistance. Clin. Microbiol. Rev. 12:147–179.
Poppe, C., R. J. Irwin, C. M. Forsberg, R. C. Clarke, and J. Oggel. 1991. The prevalence of Salmonella enteritidis and other Salmonella spp. among Canadian registered commercial layer flocks. Epidemiol. Infect. 106:259–270.[Medline]
Public Health Agency of Canada. 2005. Laboratory Surveillance Data for Enteric Pathogens in Canada: Annual Summary 2002 and 2003. Public Health Agency of Canada, Ottawa, Ontario, Canada.
Romling, U., W. Bokranz, W. Rabsch, X. Zogaj, M. Nimtz, and H. Tschape. 2003. Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease. Int. J. Med. Microbiol. 293:273–285.[CrossRef][ISI][Medline]
Romling, U., M. Rohde, A. Olsen, S. Normark, and J. Reinkoster. 2000. AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36:10–23.[CrossRef][ISI][Medline]
Romling, U., W. D. Sierralta, K. Eriksson, and S. Normark. 1998. Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol. Microbiol. 28:249–264.[CrossRef][ISI][Medline]
Ryu, J. H., and L. R. Beuchat. 2005. Biofilm formation by Escherichia coli O157:H7 on stainless steel: Effect of exopolysaccharide and Curli production on its resistance to chlorine. Appl. Environ. Microbiol. 71:247–254.
Scher, K., U. Romling, and S. Yaron. 2005. Effect of heat, acidification, and chlorination on Salmonella enterica serovar Typhimurium cells in a biofilm formed at the air-liquid interface. Appl. Environ. Microbiol. 71:1163–1168.
Sibley, C. D., S. R. MacLellan, and T. Finan. 2006. The Sinorhizobium meliloti chromosomal origin of replication. Microbiology 152:443–455.
Solano, C., B. Garcia, J. Valle, C. Berasain, J. M. Ghigo, C. Gamazo, and I. Lasa. 2002. Genetic analysis of Salmonella enteritidis biofilm formation: Critical role of cellulose. Mol. Microbiol. 43:793–808.[CrossRef][ISI][Medline]
Solomon, E. B., B. A. Niemira, G. M. Sapers, and B. A. Annous. 2005. Biofilm formation, cellulose production, and curli biosynthesis by Salmonella originating from produce, animal, and clinical sources. J. Food Prot. 68:906–912.[ISI][Medline]
Uhlich, G. A., P. H. Cooke, and E. B. Solomon. 2006. Analyses of the red-dry-rough phenotype of an Escherichia coli O157:H7 strain and its role in biofilm formation and resistance to antibacterial agents. Appl. Environ. Microbiol. 72:2564–2572.
Wales, A., M. Breslin, and R. Davies. 2006a. Assessment of cleaning and disinfection in Salmonella-contaminated poultry layer houses using qualitative and semi-quantitative culture techniques. Vet. Microbiol. 116:283–293.[CrossRef][ISI][Medline]
Wales, A., M. Breslin, and R. Davies. 2006b. Semiquantitative assessment of the distribution of Salmonella in the environment of caged layer flocks. J. Appl. Microbiol. 101:309–318.[CrossRef][Medline]
Weber, H., C. Pesavento, A. Possling, G. Tischendorf, and R. Hengge. 2006. Cyclic-di-GMP-mediated signalling within the sigma network of Escherichia coli. Mol. Microbiol. 62:1014–1034.[CrossRef][ISI][Medline]
White, A. P., D. L. Gibson, W. Kim, W. W. Kay, and M. G. Surette. 2006. Thin aggregative fimbriae and cellulose enhance long-term survival and persistence of Salmonella. J. Bacteriol. 188:3219–3227.
White, A. P., and M. G. Surette. 2006. Comparative genetics of the rdar morphotype in Salmonella. J. Bacteriol. 188:8395–8406.
Winfield, M. D., and E. A. Groisman. 2003. Role of nonhost environments in the lifestyles of Salmonella and Escherichia coli. Appl. Environ. Microbiol. 69:3687–3694.
Zogaj, X., M. Nimtz, M. Rohde, W. Bokranz, and U. Romling. 2001. The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39: 1452–1463.[CrossRef][ISI][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
