Poult. Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Poult Sci 2007. 86:731-738
© 2007 Poultry Science Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takagi, S.
Right arrow Articles by Shimada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takagi, S.
Right arrow Articles by Shimada, K.

PHYSIOLOGY, ENDOCRINOLOGY, AND REPRODUCTION

Fertilizing Ability of Chicken Sperm Bearing the W Chromosome

S. Takagi, A. Tsukada, N. Saito and K. Shimada1

Laboratory of Animal Physiology, Graduate School of Bioagricultural Sciences, Nagoya University, Aichi 464-8601, Japan

1 Corresponding author: kshimada{at}agr.nagoya-u.ac.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the sex-reversed domestic fowl, spermatids and sperm carrying the female-specific W chromosome have been demonstrated, but whether the spermatids can become functional sperm and can fertilize the oocyte remains undetermined. In the present study, sex reversal was induced by injection of a nonsteroidal aromatase inhibitor (Fadrozole) into the air sac of the chicken egg on d 4 of incubation, and the chicks were reared to 18 mo old. A single elongated spermatid or sperm was isolated from the testis from either normal roosters or sex-reversed hens, and each was microinjected into a mouse oocyte and cultured for 24 h. Although injected oocytes were monitored on the stage of microscope, they were classified into groups by the number of pronuclei. Those that showed male and female pronuclei (2PN) were considered to have oocyte-activating potency. In the normal rooster group, most semen and testicular sperm induced 2PN, whereas only half of the elongated spermatids induced 2PN. In the sex-reversal group, most testicular sperm induced 2PN, whereas nearly half of the elongated spermatids induced 2PN in the oocytes. There was no pronucleus in the oocytes after microinjection of medium only. A second experiment confirmed the higher rate of oocyte activation by testicular sperm than testicular elongated spermatids. In this second experiment, individual oocytes injected with spermatids and sperm of sex-reversed hens were assayed by PCR to identify the W chromosome. Most spermatids and sperm carried Z chromosome, whereas a minority carried W chromosome. However, the sperm carrying W chromosome evoked 2PN with the same rate of oocyte activation as those carrying Z chromosome. From these results, it is concluded that the chicken elongated spermatids and sperm carrying W chromosome may possess a fertilizing ability similar to normal chicken sperm carrying the Z chromosome.

Key Words: chicken • sex reversal • W chromosome • sperm • fertilization


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The sequencing of the chicken genome through the International Chicken Genome Sequencing Consortium provides useful information to understand the genetic mechanisms that control growth, development, and diseases (Hillier et al., 2004) and emphasizes the importance of avian genetic resources. However, many genetic resources for the domestic fowl are threatened with extinction or have been eliminated, at least in part due to the reallocation of budgets at public universities, reallocation of resources to new initiatives, and difficulty in the maintenance of resources with less immediate economical value. Currently, the only practical preservation method for birds in the poultry industry involves live bird conservation (Fulton, 2006). Although cryopreservation of germplasm, such as cryopreservation of blastodermal cells, embryonic cells, and primordial germ cells is available (Petitte, 2006), each has a disadvantage in practicality. Despite relatively low fertilizing ability of frozen and thawed poultry sperm, the current cryopreservation methods apply only to sperm. This method is only effective for preservation of the Z chromosome with autosomes, but preservation of the W chromosome, which is contributed by female gametes, has not been attempted. However, successful cryopreservation of female gametes would improve the situation for avian genetic resource preservation.

Sex reversal from genotypic female to phenotypic male can be induced by several methods (Salzgeber et al., 1981; Rashedi et al., 1983; Maraud et al., 1987; Kagami and Tomita, 1990; Elbrecht and Smith, 1992; Abinawanto et al., 1998; Vaillant et al., 2001). In many cases, the gonad of the sex-reversed hen can produce not only spermatids but also sperm; however, no offspring has ever been produced. Several reasons for infertility may arise from a defect of vas deferens, low sperm counts, and the inability of sperm itself to fertilize an oocyte. The W chromosome-bearing sperm have been identified by several workers in ejaculates in chimeric chickens (Kagami et al., 1995; Simkiss et al., 1996; Tagami and Kagami, 1998) and in the testis of the sex-reversed hen (Simkiss et al., 1996; Abinawanto et al., 1998). What has not been demonstrated is whether both the W- and Z-containing spermatids can become functional sperm and whether they can fertilize the oocyte. The present study was conducted to answer these questions and connect it to application of the W chromosome containing sperm as a mean for genetic resource preservation in birds. In the first step toward this goal, it is necessary to confirm at least the fertilizing ability of the W chromosome-bearing sperm. Recently, the method of avian intracytoplasmic sperm injection (ICSI) was first established by our laboratory (Hrabia et al., 2003). However, the rate of embryo development in quail (~15%) is extremely low when compared with that in mouse oocyte (90%). Interestingly, it has been reported by Wakayama et al. (1997) that sperm-borne oocyte-activating factors and ooplasmic factors controlling formation of the male pronucleus were not species-specific, and indeed, chicken sperm extract is capable of inducing mouse oocyte activation (Dong et al., 2000; Kim and Gye, 2003). In this study, the fertilizing ability of sperm cells was tested by observing 2 pronuclei in the mouse oocyte (oocyte activation) after ICSI and spermatids, combining the subsequent identification of W chromosome-bearing sperm by PCR assay.

Herein, we report that the sperm as well as elongated spermatids carrying the W chromosome have an oocyte-activating ability, and the result indicates that they have fertilizing ability similar to normal chicken sperm carrying the Z chromosome.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
All inorganic and organic reagents were purchased from Wako Pure Chemical Industries (Osaka, Japan) unless otherwise stated.

Media
The medium used for culturing oocytes after microinjection was human tubal fluid (HTF) medium containing 5 mg/mL of BSA (fraction V; Sigma-Aldrich, St. Louis, MO). The medium used for collection of oocytes from oviducts, for collection of sperm cells, and for micromanipulation was a modified HTF (MHTF) medium with 21 mM HEPES, a reduced amount of NaHCO3 (4 mM), and 0.1 mg/mL of polyvinyl alcohol (30 to 70 kDa; Sigma-Aldrich) instead of BSA.

Induction of Sex Reversal in Chickens
A total of 200 fertile White Leghorn eggs were obtained from a commercial supplier and incubated under humid conditions at 37.8°C in a commercial incubator. On d 4 of incubation, eggs were treated for sex reversal with a single injection of nonsteroidal aromatase inhibitor (Fadrozole; Novartis, Basel, Switzerland) at a dose of 1 mg in 0.1 mL of 0.9% NaCl solution (saline) into the air sac of the eggs as described previously (Abinawanto et al., 1996). After injection, shell holes were sealed with tape, and eggs were replaced in the incubator. Treated and untreated chicks were reared to 18 mo of age under conventional management and used for collection of ejaculated sperm, testicular sperm, and elongated spermatids for ICSI.

Preparation of Ejaculated Sperm, Testicular Sperm, and Elongated Spermatids
Semen was collected from adult males after ejaculation induced by lumbar massage. Ejaculated sperm was washed with MHTF 3 times by centrifugation at 1,000 x g for 10 min and resuspended with MHTF. One part of the suspension was mixed with 2 parts of MHTF containing 12% (wt/vol) polyvinylpyrrolidone (360 kDa, Sigma-Aldrich). A testis was isolated from a mature male or sex-reversed hen. One part of testis was placed in 1 mL of MHTF and minced using a pair of fine scissors. The suspension was mixed thoroughly and kept for precipitate tubular fragments at room temperature. The supernatant was washed with MHTF 3 times by centrifugation at 1,000 x g for 10 min and resuspended with MHTF. One part of the supernatant was mixed thoroughly with 2 parts of MHTF containing 12% (wt/vol) polyvinylpyrrolidone. The final suspension, spermatozoa or spermatogenic cells at various stages of development, was placed on a plastic petri dish and covered with mineral oil (Sigma-Aldrich). Testicular elongated spermatids and sperm for ICSI in normal males and sex-reversed hens were identified according to the methods of Miller (1938).

Preparation of Mouse Oocytes
A total of 60 female mice (B6D2F1) aged 6 to 8 wk old were each induced to superovulate by i.p. injection of 7.5 IU of equine chronic gonadotropin (Teikokuzouki, Tokyo, Japan), followed by 7.5 IU of human chorionic gonadotropin (Teikokuzouki) 48 h later. Oocytes were collected from oviducts about 16 h after human chorionic gonadotropin injection. They were freed from the cumulus cells by treatment with 0.1% hyaluronidase (from bovine testis, 500 IU/mg; Sigma-Aldrich) in MHTF for 3 to 5 min. The oocytes were rinsed thoroughly and kept in HTF containing 5 mg/mL of BSA (fraction V, Sigma-Aldrich) for up to 2 h at 37°C under 5% CO2 in air.

Microinjection and Culture
Intracytoplasmic sperm injection was carried out according to Kimura and Yanagimachi (1995) under a Hoffman modulation contrast microscope (IX70, Olympus, Tokyo, Japan) using piezo micromanipulator (Prime Tech, Ibaraki, Japan). A single ejaculated or testicular sperm was sucked tail first into an injection pipette, and the head was separated from the tail by applying a few piezo pulses to the midpiece region. The isolated sperm head or elongated spermatid was injected immediately into an oocyte. Injected oocytes were kept in the operation medium (MHTF) for about 10 min on the stage of the microscope at room temperature. Ten minutes later, the oocytes were transferred into 50 µL of HTF medium under mineral oil in a plastic dish and incubated at 37°C under 5% CO2 in air. Development of oocytes was examined 3 to 7 h after the start of incubation and cultured for 20 to 24 h continuously. Two experiments were performed; in the second experiment, all oocytes were transferred to 1 µL of saline in the 0.5-mL tube individually and stored at –30°C until assayed using the PCR for W chromosome identification of sperm and spermatid.

Sex Identification of Chicks
The genotypic sex of all hatchlings after Fadrozole treatment was determined by PCR using a thermal cycler (GeneAmp PCR System 9700, Applied Biosystems, Foster City, CA) amplification for the sex chromosome-linked CHD gene as described previously (Griffiths et al., 1998). One week posthatch, blood samples were collected at the median wing vein, and red blood cell DNA was isolated to perform sexing. Polymerase chain reactions were performed in a 15-µL mixture containing 0.2 mM each deoxynucleoside triphosphate (Takara, Shiga, Japan), 0.4 µM each primers, 0.3 U of Ex Taq polymerase (Takara), and one-tenth 10 x PCR buffer (Takara). One microliter of DNA was amplified with initial denaturation at 94 °C for 1 min, followed by 40 cycles of 94°C for 20 s, 58°C for 20 s, and 72°C for 20 s, with a final extension at 72°C for 5 min using primers CHDFOR-NEW: CAAGGATGAGAAACTGTGCAAAACAG and CHDREVNEW: CTATCAGATCCAGAATATCTTCTGC (Raymond et al., 1999). After amplification, 9 µL of reaction was separated through a 3% agarose gel by electrophoresis in Tris-borate-EDTA buffer and stained with ethidium bromide before being visualized under ultraviolet light. Electrophoretic results were photographed (AE-6905 H Image Saver HR, Atto, Tokyo, Japan).

Sex Chromosome Identification of Sperm or Spermatid of Sex-Reversed Chicken Injected into Mouse Oocytes
The oocyte samples after ICSI were added with 11 µL of sterile H2O and heated to expose extract DNA at 99°C for 15 min and then placed on ice. All DNA samples were amplified with initial denaturation at 97°C for 1 min, followed by 5 cycles of 97°C for 5 s and 72°C for 30 s; 5 cycles of 97°C for 5 s, 65°C for 10 s, and 72°C for 30 s; 5 cycles of 97°C for 5 s, 60°C for 10 s and 72°C for 30 s; and 35 cycles of 97°C for 5 s, 55°C for 10 s, and 72 °C for 30 s, with a final extension at 72°C for 7 min. And then, 1 µL of PCR product was amplified again under the same conditions. Primer sets used W-chromosome specific XhoI primers, XhoI-For.: 5'-CCCAAATA-TAACACGCTTCACT-3' and XhoI-Rev.: 5'- GAAAT-GAATTATTTTCTGGCGAC-3' (Clinton et al., 2001). The PCR product in 9 µL of the reaction was separated through a 2% agarose gel by electrophoresis in Tris-borate-EDTA buffer and stained with ethidium bromide before visualization under ultraviolet light. The electrophoretic results were photographed as above.

Animals
All procedures involving animals were conducted after approval by the Institutional Animal Care and Use Committee of Nagoya University.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Chicken sperm has a unique shape. The head and tail of sperm of ejaculates from the normal rooster are about 20 and 80 µm long, respectively. Testicular sperm assumes the same size, but the head of an elongated spermatid is oval and the tail is shorter than that of mature sperm (Figure 1Go). Although sperm count is very low in the sex-reversed hen, elongated spermatids were abundant in the testis, and it forms the same shape as that of a normal rooster. Initially, it was observed that a few mouse oocytes developed up to a 2-cell stage after ICSI of either sperm of normal rooster or testicular sperm of the sex-reversed hen (Figure 2Go). It should be noted that all control oocytes never showed pronuclear formation in response to injection of medium solution (Tables 1Go and 2Go).


Figure 1
View larger version (39K):
[in this window]
[in a new window]

  		Figure 1. Sperm and elongated spermatids from a normal rooster (left panel) and a sex-reversed hen (right panel). White and black arrows indicate sperm and elongated spermatids, respectively. Bar = 10 µm.

 

Figure 2
View larger version (80K):
[in this window]
[in a new window]

  		Figure 2. Micrographs of a mouse oocyte injected with testicular sperm of a sex-reversed hen. Panel A: 2-pronuclear stage; panel B: subsequent 2-cell stage. Arrows show 2 pronuclei. Bar = 50 µm.

 

View this table:
[in this window]
[in a new window]

  		Table 1. Zygotic formation responses of mouse oocytes to microinjection of a single sperm of ejaculate, sperm, or elongated spermatid from testis of normal and sex-reversed chickens
 

View this table:
[in this window]
[in a new window]

  		Table 2. Zygotic formation responses of mouse oocytes to microinjection of a single elongated spermatid or sperm of testis from normal and sex-reversed chickens
 
Figure 3Go shows an example of micrographs of mouse oocytes after ICSI of sperm and spermatids from a normal rooster. A distinct pronucleus was seen about 3 h after ICSI of semen sperm (Figure 3Go, panel A), and 2 pronuclei were observed about 5 h after the ICSI (Figure 3Go, panel B). When testicular sperm was injected into mouse oocytes, 1 pronucleus and 2 pronuclei were observed about 3 and 5 h after ICSI, respectively (Figure 3Go, panels C and D). The same result was observed when testicular elongated spermatids were injected into mouse oocytes (Figure 3Go, panels E and F). This oocyte activation was not necessarily observed in all injected mouse oocytes, but some oocytes showed no pronucleus or only 1 pronucleus 24 h after ICSI. The numerical data including oocyte activation rate were summarized in Table 1Go. Figure 4Go shows an example of micrographs of mouse oocytes after ICSI of testicular sperm and spermatids from a sex-reversed hen. A distinct pronucleus is seen about 3 h after ICSI of testicular sperm (Figure 4Go, panel A), and 2 pronuclei are observed about 5 h after ICSI (Figure 4Go, panel B). Essentially, the same result was observed about 3 and 5 h after ICSI of testicular elongated spermatids of the sex-reversed hen (Figure 4Go, panels C and D).


Figure 3
View larger version (108K):
[in this window]
[in a new window]

  		Figure 3. Micrographs of mouse oocytes after intracytoplasmic sperm injection of chicken sperm and spermatids from a normal rooster. Panels A and B: mouse oocytes injected with ejaculated sperm; panels C and D: mouse oocytes injected with testicular sperm; panels E and F: mouse oocytes injected with a testicular elongated spermatid; panels A, C, and E are at 1 pronuclear stage; panels B, D, and F are at 2-pronuclear stage (arrows indicate pronuclei). Bar = 50 µm.

 

Figure 4
View larger version (156K):
[in this window]
[in a new window]

  		Figure 4. Micrographs of mouse oocytes after intracytoplasmic sperm injection of testicular sperm and spermatids from a sex-reversed hen. Panels A and B: mouse oocytes injected with a sperm; panels C and D: mouse oocytes injected with an elongated spermatid. Panels A and C are at the 1 pronucleus stage; panels B and D are at the 2-pronuclear stage (arrows indicate pronuclei). Bar = 50 µm.

 
Experiment 1
In experiment 1, we compared mouse oocyte activation between ejaculated sperm, testicular sperm, and elongated spermatids from normal cockerel and testicular sperm and elongated spermatid from sex-reversed hens. When mouse oocytes were injected with a single ejaculated sperm from a normal cockerel and cultured for more than 3 h, 23 out of 40 oocytes survived, and 19 out of 23 mouse oocytes (82.6%) displayed 2 pronuclei (Figure 3Go and Table 1Go).

Three oocytes and an additional oocyte showed 1 pro-nucleus and no pronucleus, respectively (Figure 3Go and Table 1Go). Microinjection of only medium solution did not induce pronucleus formation in any of the 16 oocytes cultured for more than 3 h. Injection of the testicular sperm and elongated spermatids induced 2 pronuclei in 9 and 14 oocytes out of the 11 and 29 surviving oocytes (81.8 vs. 48.3%), respectively. When mouse oocytes were injected with testicular sperm and elongated spermatid of sex-reversed hens, 41 out of 55 survived oocytes (74.6%) showed 2 pronuclei, and 16 out of 30 survived oocytes (53.3%) showed 2 pronuclei (Figure 4Go and Table 1Go), respectively.

Experiment 2
In experiment 2, we examined mouse oocyte activation by testicular sperm and elongated spermatids from normal cockerel and sex-reversed hens and identification of W chromosome. In this experiment, the zygotic formation ability of a mouse oocyte 24 h after injection of testicular sperm cells from a normal rooster and sex-reversed hen was first analyzed as in experiment 1, and, subsequently, the numerical data are summarized in Table 2Go. The oocytes were screened for the presence of the chicken W chromosome using the PCR assay only in the samples injected with material from the sex-reversed hen, because no male sperm or spermatids containing the W chromosome would be expected from the normal rooster.

When elongated spermatid of normal rooster was injected, 18 out of 33 survived oocytes (54.5%) showed 2 pronuclei. When microinjection of testicular sperm from a normal rooster was injected, 27 out of 42 survived oocytes (64.3%) showed 2 pronuclei. On the other hand, in response to microinjection of elongated spermatid of sex-reversed hen, 25 out of 50 oocytes (50%) showed 2 pronuclei. When testicular sperm was injected, 38 out of 63 oocytes (60.3%) displayed 2 pronuclei (Table 2Go). Essentially, the same results as experiment 1 were obtained in experiment 2.

Figure 5Go shows an example of PCR products of DNA fragments obtained from red blood cells of a normal rooster and a hen and sperm of a sex-reversed hen injected into mouse oocyte. The predicted band at 416 bp is characteristic for the female DNA in the chicken and is absolutely absent from the male samples as seen in red blood cell samples (Figure 5Go). Of surviving mouse oocytes 24 h after ICSI, some with 2 pronuclei showed a PCR product with a predicted size, whereas the others did not. The same is true for some oocytes with 1 pronucleus or those without pronucleus and for oocytes that did not survive the culture.


Figure 5
View larger version (20K):
[in this window]
[in a new window]

  		Figure 5. Polymerase chain reaction identification of W chromosome of sperm of sex-reversed hens injected into mouse oocyte. Five red blood cells (5RBC) and 1 red blood cell (1RBC) of female and male chickens were used for positive and negative control of PCR assay. Lane 1: molecular marker; lanes 6, 7: 2PN, mouse oocyte with 2 pronuclei; lanes 8, 9: 1PN, mouse oocyte with 1 pronucleus; lanes 10, 11: 0PN, mouse oocyte without pronucleus; lanes 12, 13: irregular, mouse oocyte with deformation, cytolysis, or irregular appearance of the cytoplasm.

 
Table 3Go is summarized from the number of the elongated spermatid and testicular sperm of sex-reversed hens containing W chromosome in the mouse oocytes. Nine out of 60 oocytes (15%) injected with the elongated spermatid were identified as cells containing the W chromosome, but the 51 remaining oocytes (85%) were identified as those containing the Z chromosome. Two out of the 9 W chromosome-containing oocytes (22.2%) showed 2 pronuclei, but 23 out of the 51 Z chromosome-containing oocytes (45.1%) showed 2 pronuclei. On the other hand, 12 out of 65 oocytes (18.5%) injected with the testicular sperm contained the W chromosome, whereas the remaining 53 oocytes (81.5%) contained the Z chromosome. Six of the 12 W chromosome-containing oocytes (50%) showed 2 pronuclei, but 32 of the 53 Z chromosome-containing oocytes (60.4%) showed 2 pronuclei.


View this table:
[in this window]
[in a new window]

  		Table 3. Identification of testicular elongated spermatids and sperm carrying W chromosomes of sex-reversed hen in mouse oocytes in relation to zygotic formation ability1
 

   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Although polyspermic fertilization is one of the unique phenomena in reproduction in aves, a single sperm is capable of activating the oocyte for further fertilization processes and embryonic development in the quail (Hrabia et al., 2003). Namely, a quail sperm injected into quail oocyte induces the formation of 2 pronuclei in the oocyte 3 h after injection and further cell division up to Eyal-Giladi and Kochav (1976) stage VII. Recently, Dong et al. (2000) and Coward et al. (2005) demonstrated that a chicken extract and phospholipase C{zeta} (PLC{zeta}) cRNA could induce Ca2+ oscillation in the mouse oocyte, respectively. These results indicate that sperm may contain an oocyte-activating factor to induce Ca2+ oscillation, which is connected to the formation of 2 pronuclei or the first step of oocyte activation in mouse. Although the mechanism by which sperm trigger Ca2+ oscillation has been a matter of controversy, many reports argue in favor of a sperm-specific soluble factor. Recent work by Saunders et al. (2002) proposed that PLC{zeta} is the best candidate factor. Phospholipase C{zeta} may induce inositol 1,4,5-triphosphate (InsP3), and InsP3 interacts with InsP3 receptors at the endoplasmic reticulum, thus inducing Ca2+ release. Additionally, Ca2+ oscillation is thought to involve decondensation of chromosomes and resumption of meiotic division (Kline and Kline, 1992). Kim and Gye (2003) also confirmed the oocyte activation of mouse after intracytoplasmic injection of chicken sperm extract by observing complete pronuclear formation. Although these previous studies have not clarified how the effective dose of sperm extract or PLC{zeta} is physiological or is related to the number of sperm, the present study clearly demonstrated the formation of 2 pronuclei, indicating that both a single sperm and elongated spermatids from the normal rooster can activate mouse oocyte (Figures 2Go, 3Go, and 4Go). Furthermore, it is evident that a single sperm has a higher rate of oocyte activation than an elongated spermatid of normal rooster (Tables 2Go and 3Go), suggesting that sperm may possess a larger amount of oocyte activation factor than an elongated spermatid, i.e., PLC{zeta} (Kline and Kline, 1992; Coward et al., 2005). Hrabia et al. (2003) also showed that a single elongated spermatid and sperm cause quail oocyte fertilization, but the difference in oocyte activation between them is not clear. Sperm cells from the normal rooster carry only Z chromosomes.

In the present study, our principal aim was to reveal whether the W-containing spermatid could become functional sperm and whether they can fertilize the oocyte. The present study clearly demonstrated that W chromosome-containing sperm and spermatid are viable and functional because they induced the formation of 2 pronuclei in the injected mouse oocyte (Figure 4Go). In the sex-reversed hens, the ratio of W and Z chromosome-bearing elongated spermatids and that of sperm was very biased. Only 15 and 18.5% were W chromosome-bearing elongated spermatids and sperm out of 60 and 65 cells examined, respectively (Table 3Go). Our previous study demonstrated that all the spermatocytes are diploid, containing ZW chromosomes in the sex-reversed hens, whereas only half of haploid spermatids have W chromosomes (Abinawanto et al., 1998); hence, nearly a 50 to 50% ratio of round spermatids carry W and Z chromosomes (Abinawanto et al., 1998). This result was obtained by FISH analysis by counting the number of round spermatids labeled with the W-specific DNA signal. Vaillant et al. (2003) reported that adult sex-reversed hens with the Fadrozole treatment have neither spermatids nor sperm in the testis but show numerous degenerated spermatids. Abinawanto et al. (1998) showed both elongated and sperm as in the present study, although the count is extremely low. These reports indicate that there is a barrier in spermiogenesis, i.e., transformation from spermatid to elongated spermatid and to sperm. Therefore, the extreme reduction of the number of W chromosome-bearing elongated spermatid as well as sperm may be attributable, at least in part, to interruption of the transformation in the sex-reversed hen. At present, it is difficult to explain this transformation problem, but W chromosome-bearing spermatids in the sex-reversed hens may not be potent enough to induce the transformation when compared with Z chromosome-bearing spermatid in normal roosters. At the same time, low concentration of plasma testosterone concentrations in the sex-reversed hens may be related to the transformation insufficiency (Abinawanto et al., 1997).

In the sex-reversed hens, a lower percentage of pronuclear formation is evident in Z chromosome-bearing elongated spermatids (45.1%) compared with those in Z chromosome-bearing sperm (60.4%), as observed in the normal rooster. Moreover, the same relationship is present in W chromosome-bearing elongated spermatids (22.2%) and those sperm (50.0%). Therefore, it may be concluded that sperm have a higher potency to activate oocyte as compared with elongated spermatid irrespective of W or Z chromosomes.

The present study provides a novel finding that the W chromosome-bearing sperm has fertilizing ability, and this opens a new way to contribute to avian genetic resource preservation. The next challenges are to clarify whether this W chromosome-bearing sperm has potency for further embryonic development.


   ACKNOWLEDGMENTS
 
We thank H. Hasegawa (Japan-Ciba-Geigy, Takarazuka, Japan) for providing us with an aromatase inhibitor (CGS16949a, Fadrozole).

Received for publication November 2, 2006. Accepted for publication December 2, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Abinawanto, K. Shimada, and N. Saito. 1997. Sex-reversal effects of nonsteroidal aromatase inhibitor on aromatase (P450arom) mRNA expression in adult chicken gonads. Jpn. Poult. Sci. 34:158–168.

Abinawanto, K. Shimada, K. Yoshida, and N. Saito. 1996. Effects of aromatase inhibitor on sex differentiation and levels of P45017{alpha} and P450arom messenger ribonucleic acid of gonads in chicken embryos. Gen. Comp. Endocrinol. 102:241–246.[ISI][Medline]

Abinawanto, C. Zhang, N. Saito, Y. Matsuda, and K. Shimada. 1998. Identification of sperm-bearing female-specific chromosome in the sex-reversed chicken. J. Exp. Zool. 280:65–72.[ISI][Medline]

Clinton, M., L. Haines, B. Belloir, and D. McBride. 2001. Sexing chick embryos: A rapid and simple protocol. Br. Poult. Sci. 42:134–138.[ISI][Medline]

Coward, K., C. P. Ponting, H. Y. Chang, O. Hibbitt, P. Savolainen, K. T. Jones, and J. Parrington. 2005. Phospholipase C{zeta}, the trigger of egg activation in mammals, is present in a non-mammalian species. Reproduction 130:157–163.[Abstract/Free Full Text]

Dong, J. B., T. S. Tang, and F. Z. Sun. 2000. Xenopus and chicken sperm contain a cytosolic soluble protein factor, which can trigger calcium oscillations in mouse eggs. Biochem. Biophys.Res. Commun. 268:947–951.[ISI][Medline]

Elbrecht, A., and R. G. Smith. 1992. Aromatase enzyme activity and sex determination in chickens. Science 255:467–470.[Abstract/Free Full Text]

Eyal-Giladi, H., and S. Kochav. 1976. From cleavage to primitive streak formation: A complementary normal table and a new look at the first stages of the development of the chick. I. General morphology. Dev. Biol. 49:321–337.[ISI][Medline]

Fulton, J. E. 2006. Avian genetic stock preservation: An industry perspective. Poult. Sci. 85:227–231.[Abstract/Free Full Text]

Griffiths, R., M. C. Double, K. Orr, and R. J. Dawson. 1998. A DNA test to sex most birds. Mol. Ecol. 7:1071–1075.[Medline]

Hillier, L. W., W. Miller, E. Birney, W. Warren, R. C. Hardison, C. P. Ponting, P. Bork, D. W. Burt, M. A. Groenen, M. E. Delany, J. B. Dodgson, A. T. Chinwalla, P. F. Cliften, S. W. Clifton, K. D. Delehaunty, C. Fronick, R. S. Fulton, T. A. Graves, C. Kremitzki, D. Layman, V. Magrini, J. D. McPherson, T. L. Miner, P. Minx, W. E. Nash, M. N. Nhan, J. O. Nelson, L. G. Oddy, C. S. Pohl, J. Randall-Maher, S. M. Smith, J. W. Wallis, S. P. Yang, M. N. Romanov, C. M. Rondelli, B. Paton, J. Smith, D. Morrice, L. Daniels, H. G. Tempest, L. Robertson, J. S. Masabanda, D. K. Griffin, A. Vignal, V. Fillon, L. Jacobbson, S. Kerje, L. Andersson, R. P. Crooijmans, J. Aerts, J. J. van der Poel, H. Ellegren, R. B. Caldwell, S. J. Hubbard, D. V. Grafham, A. M. Kierzek, S. R. McLaren, I. M. Overton, H. Arakawa, K. J. Beattie, Y. Bezzubov, P. E. Boardman, J. K. Bonfield, M. D. Croning, R. M. Davies, M. D. Francis, S. J. Humphray, C. E. Scott, R. G. Taylor, C. Tickle, W. R. Brown, J. Rogers, J. M. Buerstedde, S. A. Wilson, L. Stubbs, I. Ovcharenko, L. Gordon, S. Lucas, M. M. Miller, H. Inoko, T. Shiina, J. Kaufman, J. Salomonsen, K. Skjoedt, G. K. Wong, J. Wang, B. Liu, J. Wang, J. Yu, H. Yang, M. Nefedov, M. Koriabine, P. J. Dejong, L. Goodstadt, C. Webber, N. J. Dickens, I. Letunic, M. Suyama, D. Torrents, C. von Mering, E. M. Zdobnov, K. Makova, A. Nekrutenko, L. Elnitski, P. Eswara, D. C. King, S. Yang, S. Tyekucheva, A. Radakrishnan, R. S. Harris, F. Chiaromonte, J. Taylor, J. He, M. Rijnkels, S. Griffiths-Jones, A. Ureta-Vidal, M. M. Hoffman, J. Severin, S. M. Searle, A. S. Law, D. Speed, D. Waddington, Z. Cheng, E. Tuzun, E. Eichler, Z. Bao, P. Flicek, D. D. Shteynberg, M. R. Brent, J. M. Bye, E. J. Huckle, S. Chatterji, C. Dewey, L. Pachter, A. Kouranov, Z. Mourelatos, A. G. Hatzigeorgiou, A. H. Paterson, R. Ivarie, M. Brandstrom, E. Axelsson, N. Backstrom, S. Berlin, M. T. Webster, O. Pourquie, A. Reymond, C. Ucla, S. E. Antonarakis, M. Long, J. J. Emerson, E. Betran, I. Dupanloup, H. Kaessmann, A. S. Hinrichs, G. Bejerano, T. S. Furey, R. A. Harte, B. Raney, A. Siepel, W. J. Kent, D. Haussler, E. Eyras, R. Castelo, J. F. Abril, S. Castellano, F. Camara, G. Parra, R. Guigo, G. Bourque, G. Tesler, P. A. Pevzner, A. Smit, L. A. Fulton, E. R. Mardis, and R. K. Wilson. 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432:695–716.[Medline]

Hrabia, A., S. Takagi, T. Ono, and K. Shimada. 2003. Fertilization and development of quail oocytes after intracytoplasmic sperm injection. Biol. Reprod. 69:1651–1657.[Abstract/Free Full Text]

Kagami, H., M. E. Clark, A. M. Verrinder Gibbins, and R. J. Etches. 1995. Sexual differentiation of chimeric chickens containing ZZ and ZW cells in the germline. Mol. Reprod. Dev. 42:379–387.[ISI][Medline]

Kagami, H., and T. Tomita. 1990. Genetic and morphological studies on the right gonad of ovariectomized chickens. Jpn. Poult. Sci. 27:111–121.

Kim, S. T., and M. C. Gye. 2003. Activation of mouse oocytes following intracytoplasmic injection of chicken sperm extract. Reprod. Domest. Anim. 38:401–404.[ISI][Medline]

Kimura, Y., and R. Yanagimachi. 1995. Intracytoplasmic sperm injection in the mouse. Biol. Reprod. 52:709–720.[Abstract]

Kline, D., and J. T. Kline. 1992. Repetitive calcium transients and the role of calcium in exocytosis and cell cycle activation in the mouse egg. Dev. Biol. 149:80–89.[ISI][Medline]

Maraud, R., O. Vergnaud, and M. Rashedi. 1987. Structure of the right testis of sexually mature genetically female fowl experimentally masculinized during embryonic life and submitted to a posthatching left castration. Gen. Comp. Endocrinol. 68:208–215.[ISI][Medline]

Miller, R. A. 1938. Spermatogenesis in a sex-reversed female and in normal males of the domestic fowl, Gallus domesticus. Anat. Rec. 70:155–159.

Petitte, J. N. 2006. Avian germplasm preservation: Embryonic stem cells or primordial germ cells? Poult. Sci. 85:237–242.[Abstract/Free Full Text]

Rashedi, M., R. Maraud, and R. Stoll. 1983. Development of the testes in female domestic fowls submitted to an experimental sex reversal during embryonic life. Biol. Reprod. 29:1221–1227.[Abstract]

Raymond, C. S., J. R. Kettlewell, B. Hirsch, V. J. Bardwell, and D. Zarkower. 1999. Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development. Dev. Biol. 215:208–220.[ISI][Medline]

Salzgeber, B., M. Reyss-Brion, and E. E. Baulieu. 1981. Modifications des gonades femelles de l’embryon de poulet apres action du tamoxifene. C. R. Acad. Sci. (Paris) 293:133–138.

Saunders, C. M., M. G. Larman, J. Parrington, L. J. Cox, J. Royse, L. M. Blayney, K. Swann, and F. A. Lai. 2002. PLC{zeta}: A sperm-specific trigger of Ca2+ oscillations in eggs and embryo development. Development 129:3533–3544.[Abstract/Free Full Text]

Simkiss, K., G. Luke, and J. Behnam. 1996. Female chromosomes in cockerel ejaculates. Proc. Biol. Sci. 263:1245–1249.

Tagami, T., and H. Kagami. 1998. Developmental origin of avian primordial germ cells and its unique differentiation in the gonads of mixed-sex chimeras. Mol. Reprod. Dev. 50:370–376.[ISI][Medline]

Vaillant, S., D. Guemene, M. Dorizzi, C. Pieau, N. Richard-Mercier, and J. P. Brillard. 2003. Degree of sex reversal as related to plasma steroid levels in genetic female chickens (Gallus domesticus) treated with Fadrozole. Mol. Reprod. Dev. 65:420–428.[ISI][Medline]

Vaillant, S., S. Magre, M. Dorizzi, C. Pieau, and N. Richard-Mercier. 2001. Expression of AMH, SF1, and SOX9 in gonads of genetic female chickens during sex reversal induced by an aromatase inhibitor. Dev. Dyn. 222:228–237.[ISI][Medline]

Wakayama, T., T. Uehara, Y. Hayashi, and R. Yanagimachi. 1997. The response of mouse oocytes injected with sea urchin spermatozoa. Zygote 5:229–234.[ISI][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takagi, S.
Right arrow Articles by Shimada, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takagi, S.
Right arrow Articles by Shimada, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS