|
|
||||||||
METABOLISM AND NUTRITION |

* Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 30, 3001 Leuven, Belgium; and
UR83 Recherches Avicoles, Institut National de la Recherche Agronomique, F-37380 Nouzilly, France
1 Corresponding author: johan.buyse{at}biw.kuleuven.be
| ABSTRACT |
|---|
|
|
|---|
Key Words: genotype diet-induced thermogenesis feed intake regulation broiler chicken layer chicken
| INTRODUCTION |
|---|
|
|
|---|
In mammals, uncoupling proteins are suggested to play a role in regulation of diet-induced thermogenesis and energy partitioning (Ricquier and Bouillaud, 2000). An uncoupling protein gene homologue was cloned and sequenced from skeletal muscle of the chicken, avian uncoupling protein (avUCP; Raimbault et al., 2001). This avUCP has been proposed to play a role in thermogenesis in birds (Collin et al., 2003a,b). When 2 experimental Rhode Island Red chicken genotypes, divergently selected for low or high residual feed intake were compared, avUCP was expressed more abundantly in the inefficient genotype (Raimbault et al., 2001). This genotype consumes 30 to 40% more feed for the same BW and egg production and shows a larger diet-induced thermogenesis than the more efficient genotype (Gabarrou et al., 1997), potentially establishing a link between avUCP expression and DIT.
Important objectives of the present study were to investigate the role of diet-induced thermogenesis in the control and regulation of voluntary feed intake in age-matched broiler and layer chickens. Furthermore, the effect of genetic background on endocrine functioning and key metabolites of the intermediary nutrient metabolism as well as on the muscular expression of avUCP of these divergent genotypes of chickens was studied.
| MATERIALS AND METHODS |
|---|
|
|
|---|
From 22 d of age, and repeated 2 times per week for 4 consecutive weeks, each time with different animals, 3 broiler cockerels and 6 (3 pairs) layer cockerels were taken from the floor pens and housed in 1 of 6 open circuit respiratory cells. The animals had feed and water ad libitum at their disposal. The same environmental conditions were used as for their floor-reared counterparts. During an adaptation period of 1 or 2 d, feed intake and BW of the chickens were closely monitored. Only the animals that were adapted properlythat gained weight and ate an appropriate amount of feed for their agewere used in the metabolic measurements. After this adaptation period, the animals were feed-deprived for 24 h though with drinking water available. Then they were given an unlimited, preweighed amount of feed during 7 consecutive hours for measuring diet-induced thermogenesis as well as feed intake. All measurements were performed on age-matched cockerels of both genotypes, and it is acknowledged that comparing BW-matched chickens might have been interesting as well. However, due to practical limitations, this comparison was not performed.
This research protocol was approved by the Ethical Commission for Experimental Use of Animals of the K.U. Leuven.
Heat Production Measurements
A detailed description of the respiratory unit is given elsewhere (Buyse et al., 1998). Briefly, it consisted of 3 separate light and temperature-controlled climatic chambers, each containing 2 respiratory cells, the gas analyzer unit, and the data acquisition system. The respiratory cells (550 x 300 x 500 mm) were made of stainless steel, and the inside temperature was measured by a platinum RTD (Pt-100, accuracy of 0.2°C; Farnell In One, Grace-Hollogne, Belgium). The paramagnetic O2 analyzer (ADC 02-823A) and the infrared CO2 analyzer (ADC D/8U/54/A; The Analytical Development Company, Hoddesdon, Herts, UK) were calibrated before every measurement by using gas mixtures with known (±0.001%) O2 and CO2 levels.
After the adaptation period, gas exchanges were measured continuously during the 24-h feed deprivation and the 7-h refeeding period. Oxygen and CO2 levels in air samples coming out of each cell were measured for 90 s every 15 min. The CO2 production and the O2 consumption of the chickens were calculated based on the differences between the gas concentrations of the outside fresh air (measured for 180 s) and the cell air. Heat production was calculated from these data according to the short formula of Romijn and Lokhorst (1961): Heat production (kJ/h) = 16.18 O2 (L/h) + 5.02 CO2 (L/h). The third term for urinary N excretion was omitted because it typically induces an error of <1%. To assess DIT, the difference between the average value for HP during the last 8 h of the feed deprivation period and the HP at every measuring point during the refeeding period was calculated. The DIT was then estimated as the area under the HP-curve during the refeeding period and was expressed as a fraction of the feed intake during that interval.
Measurements and Sampling
The individual BW of the chickens was recorded before and after feed withdrawal and after the refeeding period, when feed intake was also determined. Blood samples were collected after feed deprivation and after refeeding from a wing vein using a heparinized syringe and were immediately put on crushed ice. After euthanasia, samples were taken of the gastrocnemius muscle, snap frozen in liquid nitrogen, and stored at 80°C for posterior determination of avUCP expression.
avUCP mRNA Expression
Total mRNA extraction from gastrocnemius muscle and reverse transcription were performed as described by Cassy et al. (2004). Expression of mRNA encoding for avUCP was analyzed by real-time PCR on 1/50 diluted reverse transcription products using specific primers (forward: CTACGACCTCATCAAGGACACA and reverse: GAAGGCAGCCACGAAGTGA). Efficiency of the real-time avUCP PCR was calculated from standard curves. The PCR products obtained were checked for their nucleotide sequence, and dissociation curves were determined to evaluate the quality of each run completed using an ABI prism apparatus and software (Applied Biosystems, Courtaboeuf, France). The level of 18S ribosomal RNA (18S rRNA), chosen as the reference gene, was determined using the Predeveloped TaqMan Ribosomal RNA control kit (Applied Biosystems, Courtaboeuf, France) according to the manufacturers recommendations. Results were expressed as the ratio between expression of avUCP and that of 18S rRNA from each sample.
Plasma Metabolites and Hormones
Plasma glucose (IL Test kit, No. 182508-00), triglyceride (IL Test kit, No. 181610-60), and uric acid (IL Test kit, No. 181685-00) concentrations were measured spectrophotometrically with an automated apparatus (Monarch Chemistry System, Instrumentation Laboratories, Zaventem, Belgium). Plasma free fatty acid (FFA) concentrations were measured by the Wako NEFA C test kit (Wako Chemicals GmbH, Neuss, Germany), an enzymatic colorimetric test modified to use in the Monarch Chemistry System. Plasma 3,5,3'-triiodothyronine (T3) and thyroxine (T4) concentrations were measured using a specific radioimmunoassay as described by Darras et al. (1992). Intraassay coefficients were 4.1 and 4.7% for T3 and T4, respectively. Plasma leptin levels were measured using a multi-species leptin RIA kit (Linco Research Inc., St. Charles, MO) validated for chicken plasma (Dridi et al., 2000).
Statistical Analysis
All results were analyzed by ANOVA with genotype and age as classification variables (SAS for Windows, version 8e, SAS Institute Inc., Cary, NC). The level of P < 0.05 was considered significant. For the plasma metabolite and hormone concentrations, there were age effects for some of the parameters, but no significant interactions between genotype and age were found for any of the parameters. Therefore, to give a clear presentation of the results, these data were pooled over age and analyzed again with a 1-factor ANOVA.
| RESULTS |
|---|
|
|
|---|
|
|
|
avUCP mRNA Expression
The data of avUCP mRNA expression, relative to the expression of the reference gene 18S, are given in Table 1
. No effects were observed of age or genotype on avUCP mRNA expression. No correlations were found between uncoupling protein expression and HP parameters or plasma variables.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Previous research using isoenergetic diets with substitutions between protein and fat showed that the dietary macronutrient ratio did not affect DIT in a significant manner (Swennen et al., 2004, 2006). The results of these studies could not confirm the hierarchic oxidation/storage model as formulated by Stubbs et al. (1997) for adult mammals, nor could the model be refuted. The fact that the animals used in our previous experiments were juvenile, fast-growing broiler chickens might have an influence on energy and nutrient partitioning because a substantial amount of the ingested nutrients would be used for growth and a smaller fraction would be oxidized in comparison to adult birds. Furthermore, it is also possible that the macronutrient ratio in the diet (independent of energy supply) does not influence DIT and possibly also satiety in these broiler chickens in the same degree observed in mammals. It is consequently hypothesized that the mechanisms linking DIT to feed intake might be disturbed or at least less active in the broiler chicken. This could be a result of intensive selection for a high growth rate, which resulted in an increased appetite as reported by Denbow (1994), Dunnington and Siegel (1996), and others. Burkhart et al. (1983) proved that selection for growth influenced the hypothalamic satiety signals in a negative way. The same conclusion was reached by Bokkers and Koene (2003), who demonstrated that broilers did not show an upper set point for controlling eating behavior and probably eat to their maximal physical capacity. In contrast, the eating behavior of layer chickens is controlled equally by satiety and hunger mechanisms (Bokkers and Koene, 2003). Thus, it could be inferred that chickens of a layer strain, and thus not selected for growth, might show a stronger relation between DIT and feed intake. Indeed, the diet-induced thermogenesis per gram feed intake was significantly higher for the layer cockerels compared with the broiler chickens. However, in spite of the higher DIT found in the cockerels of the layer genotype, the feed intake per MBW (per 7 h) was also significantly higher in these animals compared with age-matched broilers. It is therefore tempting to conclude that in growing chickens, DIT might not regulate feed intake. The difference in physical capacity between both genotypes might have influenced the obtained data. In addition, it is possible that the diet composition affected DIT measurements. Because the cockerels of both genotypes were reared on a commercial diet formulated according to the needs of broiler chickens, the layer cockerels possibly ingested a relative oversupply of nutrients, resulting in an increased HP after feed intake and consequently an increased DIT. However, because these parameters were not assessed in the present study, no firm conclusions can be drawn.
The DIT per MBW, per 7 h and per feed intake, decreased significantly with age for both genotypes. This was also observed in our previous study with genetically fat and lean genotypes of broiler chickens (Swennen et al., 2006). As a consequence of the smaller proportion of the ingested energy being combusted with age, a greater percentage is available for deposition in the body, most probably under the form of fat. Indeed, the abdominal fat pad is a late maturing tissue (Govaerts et al., 2000) because its weight (absolute and proportional) increases with age.
avUCP mRNA Expression
Expression of avUCP mRNA was not influenced by genotype or age in the present experiment. This uncoupling protein is possibly involved in HP (Raimbault et al., 2001; Collin et al., 2003a), and its expression is strongly regulated by thyroid status (Collin et al., 2003b). The avUCP is also suggested to be involved in the limitation of reactive oxygen species generation in mitochondria (Criscuolo et al., 2005). The present results do not support the hypothesis of an involvement of avUCP in the higher DIT measured in the layer strain, although Raimbault et al. (2001) showed a 30% higher avUCP mRNA expression in inefficient R+ cockerels characterized by a 84% higher DIT than efficient R cockerels. However, our result is consistent with recent results from Cassy et al. (2005) showing similar avUCP mRNA expressions in broiler chickens from a single commercial broiler line but characterized by high (1.97) or low (1.70) feed conversion ratios. In the absence of any specific antibody recognizing the avUCP protein, it is difficult to draw conclusions about the avUCP protein expression, and its real involvement in HP and diet-induced thermogenesis is still debated (Mozo et al., 2005).
Plasma Metabolites and Hormones
The decrease in plasma levels of FFA and the increase of plasma concentrations of triglyceride and glucose after the refeeding period, compared with feed-deprived levels, are in agreement with previous findings (Buyse et al., 2000; Swennen et al., 2005). A more detailed discussion is provided by these authors.
The higher triglyceride concentration in the plasma of the layer cockerels might result from an augmented de novo lipogenesis on the one hand or from a decreased clearance of triglycerides to the adipose and other tissues on the other hand. Considering the genetic background and the age of the animals at experimentation, it is not likely that the layer cockerels had a higher de novo lipogenesis than the broilers. Indeed, unlike layer chickens, broilers are selected for an increased growth rate and an unfavorable indirect response to this selection is an increased fat deposition (Barbato, 1992; Havenstein et al., 2003). Thus, a decreased clearance is more likely. Indeed, March (1984) showed that the rate with which triglycerides left the circulation was generally faster in broilers than in White Leghorn chickens. In addition, Sato et al. (2006) found a tendency for a lower plasma triglyceride level in broiler compared with layer embryos. The authors suggested that broiler embryos used more lipids than layer embryos. A similar pattern was observed for circulating glucose levels. Mahagna and Nir (1996) found lower glucose concentrations in the plasma of young (up to 3 wk of age) broiler chickens compared with chicks of a layer strain. They hypothesized that the glucose uptake by the high-energy-demanding organs was larger in the broiler than in the layer chicks. The decreased circulating glucose levels in the broiler chickens compared with the layer cockerels found in the present study support this hypothesis.
Plasma FFA levels were significantly increased in the layer cockerels compared with the broiler chickens. Circulating FFA levels are the result of lipolysis on the one hand and cellular uptake of FFA by the cells for energy or lipogenesis (in liver) on the other hand. The elevated circulating FFA levels in the layer chickens were probably the consequence of a reduced uptake by peripheral tissues. An increase in lipolysis is not very likely; both genotypes were reared on commercial broiler diets, and consequently, dietary energy intake by the layer cockerels was probably more than sufficient for maintenance. Similarly, the layer cockerels were relatively overfed with dietary proteins, possibly resulting in an increased amino acid oxidation. This elevated amino acid catabolism is reflected by the increased uric acid levels in the plasma of the layer cockerels compared with the broilers after refeeding. The fact that no differences in circulating uric acid levels are found in feed-deprived state supports this hypothesis.
As discussed for the DIT measurements, it is possible that the higher metabolite concentrations in the plasma of the layer compared with the broiler cockerels reflect a relative oversupply of dietary nutrients in the former group due to the use of a commercial broiler diet for both genotypes. In this respect, it would have been interesting to study both genotypes when reared on a layer diet as well. Indeed, Zhao et al. (2004) showed that for certain parameters, the differences between layer and broiler chickens depended on the diet provided. They reared layer and broiler chickens on a commercial broiler diet and a commercial layer diet from 1 to 42 d of age. When reared on the same diet, the differences in growth potential between broiler and layer chickens were still significant, reflecting their genetic background. Similarly, muscle growth hormone receptor mRNA expression was not affected by diet exchange but maintained genotype-specific features. In contrast, pituitary growth hormone mRNA and hypothalamic somatostatin mRNA expression were inversed by the diet, suggesting that these genes are sensors to nutritional factors. However, due to practical limitations, it was not possible to compare the genotypes on both types of diet in the present study.
Plasma T3 values significantly increased after the 7-h refeeding period compared with feed-deprived levels. Plasma T4 levels showed an opposite pattern compared with T3 values after refeeding, as observed previously (Geris et al., 1999; Buyse et al., 2000, 2002; Swennen et al., 2005, 2006). Feed-deprived plasma T3 levels were significantly higher in the layer cockerels compared with the broiler chickens. Because the level of T3 in the plasma is positively correlated with HP (Klandorf et al., 1981), this corroborates the higher feed-deprived HP in the former group. After refeeding, however, the difference in circulating T3 levels between the genotypes disappeared, although the genotypic difference in refed HP was even more pronounced. It is possible that a larger proportion of the circulating T3 in the layer cockerels is taken up by the cells for binding to a nuclear receptor, thus increasing oxidative phosphorylation and subsequently HP. Plasma T4 levels were increased in the broiler chickens compared with the layer cockerels. The inversely related pattern of T3 and T4 due to genotype as well as nutritional state points to the T3-driven feedback on thyroid functioning (through thyrotropin-releasing hormone/thyroid stimulating hormone) and hence T4 production (Decuypere and Kühn, 1988; Kühn et al., 1993; Decuypere et al., 2005). Thus, the driving forces for these effects are probably regulatory effects on deiodination (affecting T3 formation as well as T3 degradation).
In conclusion, broiler chickens were more efficient in retaining ME for productive purposes compared with age-matched layer cockerels. In spite of an elevated diet-induced thermogenesis relative to their MBW, the layer cockerels also had a higher feed intake during the 7-h refeeding period than the broilers. Thus, the model of Stubbs et al. (1997) as postulated for adult mammals could not be corroborated, or in other words, diet-induced thermogenesis did not have a feedback effect on feed intake in these genotypes. The avUCP mRNA expression was not influenced by genotype, and consequently, the hypothesis of an involvement of avUCP in the higher DIT measured in the layer compared with the broiler cockerels was not supported. The elevated levels of metabolites in the plasma of the layer compared with the broiler cockerels might reflect a relative oversupply of nutrients in the former group.
| ACKNOWLEDGMENTS |
|---|
Received for publication August 29, 2006. Accepted for publication January 21, 2007.
| REFERENCES |
|---|
|
|
|---|
Bokkers, E. A. M., and P. Koene. 2003. Eating behavior, and preprandial and postprandial correlations in male broiler and layer chickens. Br. Poult. Sci. 44:538544.[ISI][Medline]
Burkhart, C. A., J. A. Cherry, H. P. Van Krey, and P. B. Siegel. 1983. Genetic selection for growth rate alters hypothalamic satiety mechanisms in chickens. Behav. Genet. 13:295300.[ISI][Medline]
Buyse, J., E. Decuypere, V. M. Darras, L. M. Vleurick, E. R. Kühn, and J. D. Veldhuis. 2000. feed deprivation and feeding is associated with rapid and interdependent changes in the somatotropic and thyrothrophic axes. Br. Poult. Sci. 41:107116.[ISI][Medline]
Buyse, J., G. P. Janssens, and E. Decuypere. 2001. The effects of dietary L-carnitine supplementation on the performance, organ weights and circulating hormone and metabolite concentrations of broiler chickens reared under a normal of low temperature schedule. Br. Poult. Sci. 42:230241.[ISI][Medline]
Buyse, J., K. Janssens, S. Van der Geyten, P. Van As, E. Decuypere, and V. M. Darras. 2002. Pre- and postprandial changes in plasma hormone and metabolite levels and hepatic deiodinase activities in meal-fed broiler chickens. Br. J. Nutr. 88:641653.[ISI][Medline]
Buyse, J., H. Michels, J. Vloeberghs, P. Saevels, J. M. Aerts, B. Ducro, D. Berckmans, and E. Decuypere. 1998. Energy and protein metabolism between 3 and 6 weeks of age of male broiler chickens selected for growth rate for improved feed efficiency. Br. Poult. Sci. 39:264272.[ISI][Medline]
Cassy, S., A. Collin, P. Chartrin, E. Baéza, and Y. Jégo. 2005. Métabolisme oxydatif des acides gras et efficacité alimentaire chez le poulet. Journées de la Recherche Avicole 6:325329.
Cassy, S., S. Metayer, S. Crochet, N. Rideau, A. Collin, and S. Tesseraud. 2004. Leptin receptor in the chicken ovary: Potential involvement in ovarian dysfunction of ad libitum-fed broiler breeder hens. Reprod. Biol. Endocrinol. 2:7282.[Medline]
Collin, A., J. Buyse, P. Van As, V. M. Darras, R. D. Malheiros, V. M. B. Moraes, G. E. Reyns, M. Taouis, and E. Decuypere. 2003a. Cold-induced enhancement of avian uncoupling protein expression, heat production, and triiodothyronine concentrations in broiler chicks. Gen. Comp. Endocrinol. 130:7077.[ISI][Medline]
Collin, A., M. Taouis, J. Buyse, N. B. Ifuta, V. M. Darras, P. Van As, R. D. Malheiros, V. M. Moraes, and E. Decuypere. 2003b. Thyroid status, but not insulin status, affects expression of avian uncoupling protein mRNA in chicken. Am. J. Physiol. Endocrinol. Metab. 284:771777.
Considine, R. V. 1997. Weight regulation, leptin and growth hormone. Horm. Res. 48:116121.[ISI][Medline]
Criscuolo, F., M. M. Gonzalez-Barroso, Y. Le Maho, D. Ricquier, and F. Bouillaud. 2005. Avian uncoupling protein expressed in yeast mitochondria prevents endogenous free radical damage. Proc. Biol. Sci. 272:803810.[Medline]
Darras, V. M., T. J. Visser, L. R. Berghman, and E. R. Kuhn. 1992. Ontogeny of type I and III deiodinase activities in embryonic and posthatch chicks: Relationship with changes in plasma triiodothyronine and growth hormone levels. Comp. Biochem. Physiol. 103A:131136.[Medline]
Decuypere, E., and E. R. Kühn. 1988. Thyroid hormone physiology in Galliformes: Age and strain related changes in physiological control. Am. Zool. 28:401415.[ISI]
Decuypere, E., P. Van As, S. Van der Geyten, and V. M. Darras. 2005. Thyroid hormone availability and activity in avian species: A review. Domest. Anim. Endocrinol. 29:6377.[ISI][Medline]
Denbow, D. M. 1994. Peripheral regulation of feed intake in poultry. J. Nutr. 124:13491354.
Dridi, S., J. Williams, V. Bruggeman, O. Onagbesan, N. Raver, E. Decuypere, J. Djiane, A. Gertler, and M. Taouis. 2000. A chicken leptin-specific radioimmunoassay. Domest. Anim. Endocrinol. 18:325335.[ISI][Medline]
Dunnington, E. A., and P. B. Siegel. 1996. Long-term divergent selection for eight-week body weight in White Plymouth Rock chickens. Poult. Sci. 75:11681179.[ISI][Medline]
Gabarrou, J. F., P. A. Geraert, F. Picard, and A. Bordas. 1997. Diet-induced thermogenesis in cockerels is modulated by genetic selection for high or low residual feed intake. J. Nutr. 127:23712376.
Geris, K. L., L. R. Berghman, E. R. Kühn, and V. M. Darras. 1999. The drop in plasma thyrotropin concentrations in fasted chickens is caused by an action at the level of the hypothalamus: Role of corticosterone. Domest. Anim. Endocrinol. 16:231237.[ISI][Medline]
Govaerts, T., G. Room, J. Buyse, M. Lippens, G. De Grootte, and E. Decuypere. 2000. Early and temporary quantitative feed restriction of broiler chickens. 2. Effects on allometric growth and growth hormone secretion. Br. Poult. Sci. 41:355362.[ISI][Medline]
Havenstein, G. B., P. R. Ferket, and M. A. Qureshi. 2003. Carcass composition and yield of 1957 versus 2001 broilers when fed representative 1957 and 2001 broiler diets. Poult. Sci. 82:15091518.
Hocking, P. M., B. O. Hughes, and S. Keer-Keer. 1997. Comparison of food intake, rate of consumption, packing activity and behaviour in layer and broiler breeder males. Br. Poult. Sci. 38:237240.[ISI][Medline]
King, J. R., and D. S. Farmer. 1961. Biology and Comparative Physiology of Birds. Academic Press, New York, NY.
Klandorf, H., P. J. Sharp, and M. G. MacLeod. 1981. The relation between heat production and concentration of plasma thyroid hormones in the domestic hen. Gen. Comp. Endocrinol. 45:513520.[ISI][Medline]
Kühn, E. R., L. R. Berghman, L. Moons, E. Vandesande, E. Decuypere, and V. M. Darras. 1993. Hypothalamic and peripheral control of thyroid function during the life cycle of the chicken. Pages 2946 in Avian Endocrinology. P. J. J. Sharp, ed. Endocrinol. Ltd., Bristol, UK.
Leclercq, B., J. C. Blum, and J. P. Boyer. 1980. Selecting broilers for low or high abdominal fat: Initial observations. Br. Poult. Sci. 21:107113.[ISI]
Mahagna, M., and I. Nir. 1996. Comparative development of digestive organs, intestinal disaccharidases and some blood metabolites in broiler and layer-type chicks after hatching. Br. Poult. Sci. 37:359371.[ISI][Medline]
March, B. E. 1984. Plasma triglyceride and glucose clearance in broiler-type and White Leghorn chickens with different degrees of adiposity. Poult. Sci. 63:15861593.[ISI][Medline]
Masic, B., D. G. M. Wood-Gush, I. J. H. Duncan, C. McCorquodale, and C. J. Savory. 1974. A comparison of the feeding behaviour of young broiler and layer males. Br. Poult. Sci. 15:499505.[ISI]
Mozo, J., Y. Emre, F. Bouillaud, D. Ricquier, and F. Criscuolo. 2005. Thermoregulation: What role for UCPs in mammals and birds? Biosci. Rep. 25:227249.[ISI][Medline]
Muramatsu, T., Y. Aoyagi, J. Okumura, and I. Tasaki. 1987. Contribution of whole-body protein synthesis to basal metabolism in layer and broiler chickens. Br. J. Nutr. 57:267277.
Raimbault, S., S. Dridi, F. Denjean, J. Lachuer, E. Couplan, F. Bouillaud, A. Bordas, C. Duchamp, M. Taouis, and D. Ricquier. 2001. An uncoupling protein homologue putatively involved in facultative muscle thermogenesis in birds. Biochem. J. 353:441444.[ISI][Medline]
Ricquier, D., and F. Bouillaud. 2000. Mitochondrial uncoupling proteins: From mitochondria to the regulation of energy balance. J. Physiol. 529.1:310.
Romijn, C., and W. Lokhorst. 1961. Some aspects of energy metabolism in birds. Pages 4659 in Proc. IInd Symp. Energy Metab. Eur. Assoc. Animal Prod., Lunteren, the Netherlands.
Sato, M., T. Tachibana, and M. Furuse. 2006. Heat production and lipid metabolism in broiler and layer chickens during embryonic development. Comp. Biochem. Physiol. A 143:382388.[Medline]
Savory, C. J. 1974. Growth and behaviour of chicks fed on pellets or mash. Br. Poult. Sci. 15:281286.[ISI]
Stubbs, R. J., A. M. Prentice, and W. P. T. James. 1997. Carbohydrates and energy balance. Ann. N. Y. Acad. Sci. 819:4469.[ISI][Medline]
Swennen, Q., G. P. J. Janssens, A. Collin, E. Le Bihan-Duval, K. Verbeke, E. Decuypere, and J. Buyse. 2006. Diet-induced thermogenesis and glucose oxidatin in broiler chickens: Influence of genotype and diet composition. Poult. Sci. 85:731742.
Swennen, Q., G. P. J. Janssens, E. Decuypere, and J. Buyse. 2004. Effects of substitution between fat and protein on feed intake and its regulatory mechanisms in broiler chickens: Energy and protein metabolism and diet-induced thermogenesis. Poult. Sci. 83:19972004.
Swennen, Q., G. P. J. Janssens, S. Millet, G. Vansant, E. Decuypere, and J. Buyse. 2005. Effects of substitution between fat and protein on food intake and its regulatory mechanisms in broiler chickens: Endocrine functioning and intermediary metabolism. Poult. Sci. 84:10511057.
Zhao, R., E. Muehlbauer, E. Decuypere, and R. Grossmann. 2004. Effect of genotype-nutrition interaction on growth and somatotropic gene expression in the chicken. Gen. Comp. Endocrinol. 136:211.[ISI][Medline]
This article has been cited by other articles:
![]() |
Q. Swennen, P.-J. Verhulst, A. Collin, A. Bordas, K. Verbeke, G. Vansant, E. Decuypere, and J. Buyse Further Investigations on the Role of Diet-Induced Thermogenesis in the Regulation of Feed Intake in Chickens: Comparison of Adult Cockerels of Lines Selected for High or Low Residual Feed Intake Poult. Sci., September 1, 2007; 86(9): 1960 - 1971. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |