Poult. Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Poult Sci 2007. 86:1174-1179
© 2007 Poultry Science Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leclerc, B.
Right arrow Articles by Kühnlein, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leclerc, B.
Right arrow Articles by Kühnlein, U.

MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY

Ontogenesis of the Expression of Prolactin Receptor Messenger Ribonucleic Acid During Late Embryogenesis in Turkeys and Chickens

B. Leclerc*, D. Zadworny*,1, G. Bédécarrats{dagger} and U. Kühnlein*

* Department of Animal Science, McGill University, Sainte-Anne-de-Bellevue, Québec, Canada H9X 3V9; and {dagger} Department of Animal and Poultry Science, University of Guelph, Ontario, Canada N1G 2W1

1 Corresponding author: david.zadworny{at}mcgill.ca


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Changes in circulating levels of prolactin (PRL) and tissue content of PRL receptor (PRLR) messenger RNA (mRNA) in the liver, pancreas, kidney, and gonads (testis/ovary) were measured in turkey and chicken embryos from embryonic day (ED) 21 or ED15, respectively, to 1 d after hatch by real-time PCR. There were no differences between the sexes in chickens or turkeys. Both species had very similar patterns of PRL release and expression of PRLR mRNA, and no major differences were observed between turkey or chicken embryos. Plasma levels of PRL increased from low levels during the last week of embryonic development and were at significantly higher levels (about 4-fold) by 1 d after hatch. Similarly, in all tissues the content of PRLR mRNA was minimal at the outset and increased to reach maxima about the time of hatch. In both species, the highest levels of transcript were observed in the kidney followed by the gonad, liver, and pancreas. The tissue content of PRLR was correlated (0.6 to 0.8 dependent on the tissue) to circulating levels of PRL, which suggested that PRL may be associated with an increase in its receptor number around the time of hatch. Because levels of PRL and tissue content of PRLR mRNA increased around the time of hatch, this suggests that these tissues may be targets for PRL and may be involved in the physiologic changes occurring in embryos around the time of hatching.

Key Words: prolactin receptor • liver • pancreas • kidney • gonad


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prolactin (PRL) is a polypeptide hormone that is produced and secreted mainly by the lactotroph cells of the adenohypophysis. In vertebrates, PRL is thought to be involved in modulating an extraordinary diversity of biological processes, and greater than 300 separate actions have been assigned to it (Bole-Feysot et al., 1998). These roles have been broadly categorized as those that affect 1) water and electrolyte metabolism, 2) growth and development, 3) endocrine systems and metabolism, 4) brain and behavior, 5) reproduction, and 6) immunoregulation and protection. The most studied role in avian species has involved the actions of PRL during the egg incubation phase of broody behavior. However, the physiological roles of PRL during avian embryogenesis have not been extensively studied.

Lactotroph cells differentiate late in embryonic development, and immunoreactive PRL is detectable by embryonic day (ED) 15 to 17 in chicks (Kansaku et al., 1994; Sasaki et al., 2003; Fu et al., 2004; Zheng et al., 2005) and ED23 in turkeys (Bédécarrats et al., 1999) although PRL transcripts are detectable at earlier stages (Kansaku et al., 1994; Bédécarrats et al., 1999). Subsequent to lactotroph differentiation, PRL is released into the circulation, and during the last week of embryogenesis, levels of PRL progressively increase and reach maxima at about the time of hatch (Ishida et al., 1991; Bédécarrats et al., 1999). Moreover, the time of hatch is associated with a significant shift in the circulating form of PRL isoform (Bédécarrats et al., 1999). The temporal relationship between increased levels of PRL and the hatch of the embryo suggests that PRL may participate in various physiological systems to adapt the embryo to ex ovo life.

The biological actions of PRL are mediated by binding to its receptor (PRLR), and receptors have been detected in the digestive, osmoregulatory, immune, reproductive, and neural system in adult chickens and turkeys (Tanaka et al., 1992; Zhou et al., 1996; Ohkubo et al., 1998b; Mao et al., 1999). The broad distribution of the receptor is consistent with the multiplicity of the physiological processes that PRL is known to be involved in. Moreover, levels of PRLR have been observed to vary according to the physiological status of the hen at least in some tissues such as the adenohypophysis and hypothalamus (Zhou et al., 1996; Ohkubo et al., 1998a). The single study measuring PRLR mRNA during embryogenesis compared levels of receptor in intestinal and kidney tissue between ED17 and ED19, and d 2 and 28 posthatch (Yamamoto et al., 2003). Yamamoto et al. reported that there was no change in levels of PRLR mRNA during that interval. However, because the levels of PRLR are expected to be quite low, the ribonuclease protection assay might have had insufficient sensitivity to detect changes in tissue content. Accordingly, in this study a real-time PCR (Q-PCR) assay was designed and validated to assess levels of PRLR mRNA in individual tissues from turkeys and chickens during the last week of embryogenesis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Sampling
Eggs from commercial strains of white Medium Hybrid turkeys (Hybrid Turkeys Inc., Kitchener, Ontario, Canada) and white Hyline W98 Leghorn chickens (HyLine International, West Des Moines, IA) were incubated under standard commercial conditions at 37.5°C, 85 to 86% humidity for 25 and 18 d, respectively. They were then transferred to a hatcher at 36.9°C, 90 to 92% humidity. In addition to the day of hatch and 1-d posthatch, turkey and chicken embryos (n = 10) were collected at d 21, 23, 25 and 27 or d 15, 17, and 19 of incubation, respectively, and killed by cervical dislocation. Tissue samples from the liver, kidney, pancreas, and left gonad were collected immediately after execution, snap-frozen in liquid N, and stored at –80°C until assayed.

Extraction of Total RNA
Total RNA from tissues was extracted using TRIzol reagent (Gibco BRL Products, Life Technologies, Burlington, Ontario, Canada), according to the manufacturer’s protocol. The recovered RNA was dissolved in diethyl pyrocarbonate-treated water to a final concentration of 1 µg/µL. Integrity of the RNA was electrophoretically verified in 1.2% formaldehyde agarose gels stained with ethidium bromide.

Reverse Transcription and Real-Time Quantification of tPRLR mRNA
The reverse transcription, modified from Bédécarrats et al. (1999), was carried out in a final volume of 10 µL containing 2.0 µg of total RNA and 40 pmol of antisense turkey (t)PRLR-specific primer (Invitrogen Canada Inc., Burlington, Canada).

An external standard of 332 bp (Zhou et al., 1996) was used in Q-PCR quantification to semiquantify levels of PRLR cDNA. This sequence contained a 39-bp deletion of the amplicon of 371 bp amplified from tPRLR mRNA to allow for determination of coamplification efficiency by melting point analysis or gel electrophoresis or both. The external standard was amplified by PCR at 93°C for 45 s, 56°C for 2 min, and 72°C for 90 s for 35 cycles (Zhou et al., 1996), purified from 1% agarose gel before use, and stepwise diluted 10-fold to cover the range of turkey and chicken PRLR mRNA levels in tissues amplified by Q-PCR.

Conditions for Q-PCR using the LightCycler (Roche Applied Science, Laval, Quebec, Canada) were optimized for 1) MgCl2+ concentration, 2) primer concentration, 3) annealing temperature, and 4) concentration of the cDNA. The optimized protocol for Q-PCR was as follows. An aliquot of 2 µL of a single-strand cDNA mixture was amplified by LightCycler PCR in a final volume of 20 µL containing 1x LightCycler-FastStart DNA Master SYBR Green I (Roche Applied Science), 4 mM MgCl2, and 10 pmol of forward and reverse primers (Invitrogen Canada Inc.). For the Q-PCR, a sense and an antisense tPRLR-specific primer were as designed by Zhou et al. (1996: 5'AGGAAACATTTACCTGTTGGT and 5'AAGCCATCCAGATCTGACATC). The cDNA was diluted according to the stages of the embryo development. Samples for Q-PCR were denatured at 95°C for 10 min followed by an amplification program (95°C for 10 s, 55°C for 5 s, 72°C for 16 s) for 40 cycles. Specificity of the amplifications was determined by melting curve analysis (63°C for 15 s to 95°C in 0.1°C/sec increments) and by gel electrophoresis.

To estimate the concentration (Co) of PRLR mRNA in the turkey and chicken cDNA samples, the following formula was used: CP = S Log (Co) + I, where CP is the crossing point value from the turkey and chicken samples (i.e., the point at which the fluorescence rises appreciably above the background fluorescence). The standard slope (S) represents the overall reaction efficiency and the intercept (I) of the standard represents the crossing point value on the y-axis for which the concentration equals zero. The linear regression line was obtained by plotting the crossing cycle number versus the logarithm of the concentration for each unknown sample.

PRL Radioimmunoassay
Blood samples were collected into heparinized tubes from the chorio-allantoic blood in turkey and chicken embryos from d 21 until 25 and from d 15 until 19 of incubation, respectively, and thereafter by intracardiac puncture. After centrifugation, plasma samples were stored at –80°C until assayed. Levels of PRL were measured in triplicate in aliquots of plasma (100 µL: turkey or 200 µL: chicken) by radioimmunoassay as described by Guémené et al. (1994). Concentration of PRL in the samples was estimated using GraphPad Prism (version 4.03, GraphPad Software, San Diego, CA). The intra- and interassay coefficients of variation were 5.8 and 0.5%, respectively.

Statistical Analysis
Transcript levels of PRLR mRNA in tissues (AU = arbitrary units) and circulating levels of PRL (ng/mL) in chickens or turkeys were analyzed following log transformation using ANOVA (P < 0.05) followed by the Duncan multiple range test if appropriate. Correlation coefficients were determined using linear regression analysis. Each data point represents the average ± SEM.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Levels of PRLR mRNA and Plasma PRL in Turkeys
Circulating levels of PRL gradually increased from ED21 (16 + 2 ng/mL) to reach a maxima of about 4-fold higher by 1 d after hatch (72 ± 14 ng/mL) in turkey embryos (Figures 1Go to 4GoGoGo). Similarly, steady state levels of PRLR mRNA transcript in all tissues gradually increased from low levels before hatch, then subsequently increased significantly. By 1 d after hatch, tissue content of PRLR mRNA (AU/µg of total RNA) was as follows: kidney > gonad > liver > pancreas. The correlation between the plasma concentration of PRL and PRLR mRNA content in liver, kidney, pancreas, or gonad was 0.56, 0.74, 0.66, and 0.70, respectively.


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Changes in the expression of prolactin receptor (PRLR) mRNA [arbitrary units (AU): average ± SE] in the liver and relative levels of prolactin (PRL; dashed line) in the circulation during the last week of embryogenesis in turkeys and chickens. Developmental stages in each species with common letters (PRLR: abcd or PRL: xyz) do not significantly differ. Relative levels of PRL are based on observed values on ED21 or ED15 in chickens and turkeys, respectively. H = day of hatch.

 

Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
Figure 2. Changes in the expression of prolactin receptor (PRLR) mRNA [arbitrary units (AU): average ± SE] in the pancreas and relative levels of prolactin (PRL; dashed line) in the circulation during the last week of embryogenesis in turkeys and chickens. Developmental stages in each species with common letters (PRLR: abcd or PRL: xyz) do not significantly differ. Relative levels of PRL are based on observed values on ED21 or ED15 in chickens and turkeys, respectively. H = day of hatch.

 

Figure 3
View larger version (27K):
[in this window]
[in a new window]

 
Figure 3. Changes in the expression of prolactin receptor (PRLR) mRNA [arbitrary units (AU): average ± SE] in the kidney and relative levels of prolactin (PRL; dashed line) in the circulation during the last week of embryogenesis in turkeys and chickens. Developmental stages in each species with common letters (PRLR: abcd or PRL: xyz) do not significantly differ. Relative levels of PRL are based on observed values on ED21 or ED15 in chickens and turkeys, respectively. H = day of hatch.

 

Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
Figure 4. Changes in the expression of prolactin receptor (PRLR) mRNA [arbitrary units (AU): average ± SE] in the gonad and relative levels of prolactin (PRL; dashed line) in the circulation during the last week of embryogenesis in turkeys and chickens. Developmental stages in each species with common letters (PRLR: abcd or PRL: xyz) do not significantly differ. Relative levels of PRL are based on observed values on ED21 or ED15 in chickens and turkeys, respectively. H = day of hatch.

 
Levels of PRLR mRNA and Plasma PRL in Chickens
Similar to the turkey, plasma levels of PRL were at low levels before hatch (ED15: 5 ± 1 ng/mL) then gradually increased during the late stages of embryogenesis and by 1 d after hatch were 4-fold higher (20 ± 8 ng/mL). The content of PRLR mRNA in the liver, pancreas, kidney, and gonad also gradually increased during late embryogenesis (Figures 1Go to 4GoGoGo). Subsequently, it increased significantly and by 1 d after hatch, the tissue content of PRLR mRNA (AU/µg of total RNA) was as follows: kidney > gonad > liver > pancreas. The correlation between the plasma content of PRL and the tissue content of PRLR mRNA in the liver, kidney, pancreas, and gonad was 0.73, 0.75, 0.56 and 0.78, respectively. In all tissues, the levels of PRLR mRNA were greater in the chicken than in the turkey on the day of hatch, but this difference was not significant.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Real-time PCR is a sensitive method used by many laboratories to quantify levels of specific transcripts in tissues. In particular, Q-PCR is advantageous over Northern blotting, ribonuclease protection assay or semiquantitative PCR for detecting and quantifying low abundance transcripts such as PRLR or mRNA from which only limited amounts of tissue are available. Using Q-PCR, levels of PRLR mRNA were shown to increase during the last week of embryogenesis in chickens and turkeys and reach maxima about the time of hatch (Figures 1Go to 4GoGoGo). In both species, the highest levels of PRLR were observed in the kidney, followed by the gonad, liver, and pancreas in descending order. Neither the pattern of change of tissue content of PRLR nor the absolute level of PRLR mRNA as indicated by amplification of the extracellular domain was different between the chicken and turkey. However, the latter does not preclude the possibility of differences in the levels of transcript variants as has been observed in the testes of chickens (Mao et al., 1999).

The increases in circulating level of PRL about the time of hatch are consistent with the differentiation of lactotrophs in the pituitary. In the chicken, immunoreactive PRL can be detected in the cephalic lobe of the adenohypophysis by about ED15 to ED17 (Kansaku et al., 1994; Sasaki et al., 2003; Zheng et al., 2005) and ED23 in turkeys (Bédécarrats et al., 1999), although PRL mRNA can be detected earlier (Kansaku et al. 1994; Bédécarrats et al., 1999). Consistent with lactotroph differentiation, circulating levels of PRL increased by about 4-fold from ED21 or ED15 to 1 d posthatch in turkeys and chickens, respectively, consistent with previous studies (Ishida et al., 1991; Bédécarrats et al., 1999). During the same interval, tissue content of PRLR mRNA increased in the liver, pancreas, kidney, and gonad and was correlated (0.6 to 0.8 dependent on the tissue) to the plasma concentration of PRL. This suggested that increases in PRL during embryonic development may be involved in increasing levels of its receptor in target tissues as has been observed in certain reproductive states in the hypothalamus and adenohypophysis of adult chickens and turkeys (Zhou et al., 1996; Ohkubo et al., 1998a). In support of this, in vitro stimulation of turkey pituitary glands from ED24 embryos with VIP for 4 h resulted in about a 4-fold increase in PRL and a 3-fold increase in PRLR mRNA (Leclerc et al., 2007). Conversely, Yamamoto et al. (2003) noted no change in chicken kidney or intestinal content of PRLR on ED17 and ED19 or 2 and 28 d posthatch, and they suggested that PRLR mRNA was regulated independently of the circulating levels of PRL. However, Yamamoto et al. (2003) were not able to detect PRLR mRNA in ED19 liver (detectable by ED15 using Q-PCR), and thus it is possible that their assay system (ribonuclease protection assay) might have not had sufficient sensitivity. In addition, levels of PRLR in many tissues in adult hens have no obvious relationship to circulating levels of PRL (Zhou et al., 1996; Ohkubo et al., 1998a). Furthermore, at the time of hatch, levels of many hormonal and nonhormonal factors vary in concert with PRL; hence, the observed correlation between PRL and PRLR may be spurious. Definitive proof regarding the relationship of PRL to the regulation of its receptor during embryogenesis requires further studies.

Prolactin interacts with its receptors in a wide variety of target tissues to affect physiological processes, which have been broadly grouped into actions that affect reproduction, growth and development, osmoregulation, behavior, and immunoregulation (Bole-Feysot et al., 1998). The large increases in levels of receptors in the kidney, gonad, liver, and pancreas about the time of hatch suggest that PRL may be acting in these target tissues. However, very few studies have examined the effects of PRL on avian embryonic development. For example, the increase in PRLR mRNA at hatch in pancreatic tissue may indicate that PRL is acting to stimulate the endocrine pancreas because PRL has been shown to be a mitogen in chick islet cells (Maiti et al., 1982). The latter is consistent with the observations that PRL stimulates ß-cell hyperplasia and insulin secretion and downregulates proapoptotic genes in mammals (Carlsson et al., 1997; Bordin et al., 2004), whereas in PRLR knockout mice, ß-cell hypoplasia occurs (Freemark et al., 2002). Similarly, the concurrent increase in circulating PRL and hepatic PRLR mRNA suggests that PRL may be active in stimulating this organ. In part, this effect may be moderated through thyroid hormones because injection of recombinant chicken PRL into ED19 chickens modulates hepatic metabolism of T3 and T4 (Kühn et al., 1996). The osmoregulatory ability of the embryonic kidney also changes around the time of hatch, and glomerular filtration rate significantly increases and resorption of allantoic water reserves occurs in preparation for ex ovo life (Davis et al., 1988; Murphy et al., 1991). The injection of PRL into the chorio-allantoic membrane of chicken embryos has been shown to increase the Na+-K+-ATPase activity and reduce the concentration of Na+ and Cl in allantoic fluid (Doneen and Smith, 1982) without altering the allantoic fluid volume (Murphy et al., 1986). Thus, the increase in circulating levels of PRL and kidney content of PRLR mRNA may be associated with the stimulation of NaCl resorption during the perihatch period. Evidence also suggests that PRL may affect steroid production by the gonads. During late embryogenesis, plasma levels of the sex steroids increase, which coincides with the observed increases in circulating PRL and PRLR mRNA in the gonad. In the chick embryo, gonadotrophin immunoreactive cells are the first to appear in the adenohypophysis at about ED7 (Sasaki et al., 2003), and steroid biosynthesis occurs at about the same time. At about the time of hatch, however, there is increased release of LH and FSH, and the gonads significantly increase the secretion of steroids (Gonzalez et al., 1987; Mendez-Herrera et al., 1998; Peralta et al., 2004). In many species, PRL is involved in the upregulation of gonadotrophin receptors (Bjurulf et al., 1994; Porter et al., 2000; You et al., 2000); hence, increased levels of circulating PRL and gonadal PRLR around the time of hatch suggest that PRL is involved in maintaining steroid production. The increased gonadal steroids are in turn involved in many aspects of pre- and posthatch physiology.

Many direct and indirect effects of PRL on target tissues are likely to occur during late embryogenesis in chickens and turkeys. The identification of large increases in PRLR mRNA in the kidney, gonad, liver, and pancreas at the time of hatch suggests that these tissues may be targets for PRL. To date, few physiological studies have investigated the direct effects of PRL on these tissues during embryogenesis. However, the availability of recombinant chicken (Hanks et al., 1989; Ohkubo et al., 1993) and turkey (Karatzas et al., 1993) PRL may allow for assessment of the response of these tissues to stimulation.


    ACKNOWLEDGMENTS
 
This work was supported by a grant from the Natural Sciences and Engineering Research Council of Canada to D. Zadworny and the Poultry Industry Council to G. Bédécarrats.

Received for publication May 26, 2006. Accepted for publication March 7, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Bédécarrats, G., D. Guémené, C. Morvan, U. Kühnlein, and D. Zadworny. 1999. Quantification of prolactin messenger ribonucleic acid, pituitary content and plasma levels of prolactin, and detection of immunoreactive isoforms of prolactin in pituitaries from turkey embryos during ontogeny. Biol. Reprod. 61:757–763.[Abstract/Free Full Text]

Bjurulf, E., G. Selstam, and J. I. Olofsson. 1994. Increased LH receptor mRNA and extended corpus luteum function induced by prolactin and indomethacin treatment in vivo in hysterectomized pseudopregnant rats. J. Reprod. Fertil. 102:139–145.[Abstract/Free Full Text]

Bole-Feysot, C., V. Goffin, M. Edery, N. Binart, and P. A. Kelly. 1998. Prolactin (PRL) and its receptor: Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr. Rev. 19:225–268.[Abstract/Free Full Text]

Bordin, S., M. E. Amaral, G. F. Anhe, V. Delghingaro-Augusto, D. A. Cunha, J. E. Nicoletti-Carvalho, and A. C. Boschero. 2004. Prolactin-modulated gene expression profiles in pancreatic islets from adult female rats. Mol. Cell. Endocrinol. 220:41–50.[ISI][Medline]

Carlsson, C., D. Tornehave, K. Lindberg, P. Galante, N. Billestrup, B. Michelsen, L. I. Larsson, and J. H. Nielsen. 1997. Growth hormone and prolactin stimulate the expression of rat preadipocyte factor-1/delta-like protein in pancreatic islets: Molecular cloning and expression pattern during development and growth of the endocrine pancreas. Endocrinology 138:3940–3948.[Abstract/Free Full Text]

Davis, T. A., S. S. Shen, and R. A. Ackerman. 1988. Embryonic osmoregulation: Consequences of high and low water loss during incubation of the chicken egg. J. Exp. Zool. 245:144–156.[ISI][Medline]

Doneen, B. A., and T. E. Smith. 1982. Ontogeny of endocrine control of osmoregulation in chick embryo. II. Actions of prolactin, arginine vasopressin, and aldosterone. Gen. Comp. Endocrinol. 48:310–318.[ISI][Medline]

Freemark, M., I. Avril, D. Fleenor, P. Driscoll, A. Petro, E. Opara, W. Kendall, J. Oden, S. Bridges, N. Binart, B. Breant, and P. A. Kelly. 2002. Targeted deletion of the PRL receptor: Effects on islet development, insulin production, and glucose tolerance. Endocrinology 143:1378–1385.[Abstract/Free Full Text]

Fu, X., S. Nishimura, and T. E. Porter. 2004. Evidence that lactotrophs do not differentiate directly from somatotrophs during chick embryonic development. J. Endocrinol. 183:417–425.[Abstract/Free Full Text]

Gonzalez, C. B., E. H. Charreau, A. Aragones, C. P. Lantos, and B. K. Follett. 1987. The ontogenesis of reproductive hormones in the female embryo of the domestic fowl. Gen. Comp. Endocrinol. 68:369–374.[ISI][Medline]

Guémené, D., G. Bédécarrats, C. N. Karatzas, M. Garreau-Mills, U. Kühnlein, S. Crisostomo-Pinto, and D. Zadworny. 1994. Development and validation of a homologous radioimmunoassay using a biologically active recombinant turkey prolactin. Br. Poult. Sci. 35:775–787.[ISI][Medline]

Hanks, M. C., J. A. Alonzi, P. J. Sharp, and H. M. Sang. 1989. Molecular cloning and sequence analysis of putative chicken prolactin cDNA. J. Mol. Endocrinol. 2:21–30.[Abstract/Free Full Text]

Ishida, H., K. Shimada, K. Sato, H. Seo, Y. Muramata, N. Matsui, and D. Zadworny. 1991. Developmental expression of the prolactin gene in the chicken. Gen. Comp. Endocrinol. 83:462–467.

Kansaku, N., K. Shimada, O. Terada, and N. Saito. 1994. Prolactin, growth hormone, and luteinizing hormone-ß subunit gene expression in the cephalic and caudal lobes of the anterior pituitary gland during embryogenesis and different reproductive stages in the chicken. Gen. Comp. Endocrinol. 96:197–205.[ISI][Medline]

Karatzas, C. N., D. Guémené, D. Zadworny, and U. Kühnlein. 1993. Production and characterization of recombinant turkey prolactin. Comp. Biochem. Physiol. B 106:273–280.[Medline]

Kühn, E. R., K. Shimada, T. Ohkubo, L. M. Vleurick, L. R. Berghman, and V. M. Darras. 1996. Influence of recombinant chicken prolactin on thyroid hormone metabolism in the chick embryo. Gen. Comp. Endocrinol. 103:349–358.[ISI][Medline]

Leclerc, B., D. Zadworny, G. Bédécarrats, and U. Kühnlein. 2007. Variation in expression of prolactin receptor mRNA in the hypothalamus and pituitary gland during late embryogenesis in turkeys and chickens. Gen. Comp. Endocrinol. 150:319–325.[ISI][Medline]

Maiti, B. R., S. Chakraborty, and A. Boral. 1982. Mitogenic action of prolactin on the pancreatic islet cells in the chick. Arch. Histol. Jpn. 45:449–452.[Medline]

Mao, J. N., J. Burnside, L. Li, J. Tang, C. Davolos, and L. A. Cogburn. 1999. Characterization of unique truncated prolactin receptor transcripts, corresponding to the intracellular domain, in the testis of the sexually mature chicken. Endocrinology 140:1165–1174.[Abstract/Free Full Text]

Mendez-Herrera, M. C., L. Tamez, A. Candido, J. A. Reyes-Esparza, and E. Pedernera. 1998. Follicle stimulating hormone increases somatic and germ cell number in the ovary during chick embryo development. Gen. Comp. Endocrinol. 111:207–215.[ISI][Medline]

Murphy, M. J., P. S. Brown, and S. C. Brown. 1986. Osmoregulatory effects of prolactin and growth hormone in embryonic chicks. Gen. Comp. Endocrinol. 62:485–492.[ISI][Medline]

Murphy, M. J., S. C. Brown, N. B. Clark, and J. Q. Feng. 1991. Compartmental analysis and glomerular filtration in chick embryos. Am. J. Physiol. 261:R1478–R1483.[ISI][Medline]

Ohkubo, T., M. Tanaka, K. Nakashima, and J. Sharp. 1998a. Relationship between prolactin receptor mRNA in the anterior pituitary gland and hypothalamus and reproductive state in male and female bantams (Gallus domesticus). Gen. Comp. Endocrinol. 111:167–176.[ISI][Medline]

Ohkubo, T., M. Tanaka, K. Nakashima, K. Shimada, N. Saito, and K. Sato. 1993. High-level expression of biologically active chicken prolactin in E. coli. Comp. Biochem. Physiol. Comp. Physiol. 105:123–128.[Medline]

Ohkubo, T., M. Tanaka, K. Nakashima, R. T. Talbot, and P. J. Sharp. 1998b. Prolactin receptor gene expression in the brain and peripheral tissues in broody and nonbroody breeds of domestic hen. Gen. Comp. Endocrinol. 109:60–68.[ISI][Medline]

Peralta, I., M. C. Romano, and P. N. Velazquez. 2004. Proliferative and steroidogenic effects of follicle-stimulating hormone on cultured chick embryo testis cells. Poult. Sci. 83:1193–1198.[Abstract/Free Full Text]

Porter, M. B., J. R. Brumsted, and C. K. Sites. 2000. Effect of prolactin on follicle-stimulating hormone receptor binding and progesterone production in cultured porcine granulosa cells. Fertil. Steril. 73:99–105.[ISI][Medline]

Sasaki, F., A. Doshita, Y. Matsumoto, S. Kuwahara, Y. Tsukamoto, and K. Ogawa. 2003. Embryonic development of the pituitary gland in the chick. Cells Tissues Organs 173:65–74.[ISI][Medline]

Tanaka, M., K. Maeda, T. Okubo, and K. Nakashima. 1992. Double antenna structure of chicken prolactin receptor deduced from the cDNA sequence. Biochem. Biophys. Res. Commun. 188:490–496.[ISI][Medline]

Yamamoto, I., M. Wakita, and M. Tanaka. 2003. Tissue distribution of prolactin receptor mRNA during late stage embryogenesis of the chick. Poult. Sci. 82:155–157.[Abstract/Free Full Text]

You, S., H. Kim, M. E. El Halawani, and D. N. Foster. 2000. Three different turkey luteinizing hormone receptor (tLH-R) isoforms II: Characterization of differentially regulated tLH-R messenger ribonucleic acid isoforms in the ovary. Biol. Reprod. 62:117–124.[Abstract/Free Full Text]

Zheng, J., K. Nakamura, Y. Maseki, S. M. Geelissen, L. R. Berghman, and T. Sakai. 2005. Independent differentiation of mammotropes and somatotropes in the chicken embryonic pituitary gland. Analysis by cell distribution and attempt to detect somatomammotropes. Histochem. Cell Biol. 8:1–11.[Medline]

Zhou, J. F., D. Zadworny, D. Guémené, and U. Kühnlein. 1996. Molecular cloning, tissue distribution, and expression of the prolactin receptor during various reproductive states in Meleagris gallopavo. Biol. Reprod. 55:1081–1090.[Abstract]




This article has been cited by other articles:


Home page
Poult. Sci.Home page
Z. Kang, G. Y. Bedecarrats, and D. Zadworny
Expression Patterns of the Prolactin Receptor Gene in Chicken Lymphoid Tissues During Embryogenesis and Posthatch Period
Poult. Sci., November 1, 2007; 86(11): 2404 - 2412.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leclerc, B.
Right arrow Articles by Kühnlein, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leclerc, B.
Right arrow Articles by Kühnlein, U.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS