Poult. Sci.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Poult Sci 2007. 86:1329-1335
© 2007 Poultry Science Association
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, Z.
Right arrow Articles by Hameed, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, Z.
Right arrow Articles by Hameed, A.

IMMUNOLOGY, HEALTH, AND DISEASE

Detection and Seroprevalence of Infectious Bronchitis Virus Strains in Commercial Poultry in Pakistan

Z. Ahmed*,1, K. Naeem* and A. Hameed{dagger}

* National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Park Road, Islamabad, Pakistan; and {dagger} Department of Microbiology, Quaid-I-Azam University, Islamabad, Pakistan

1 Corresponding author: drzaheer{at}comsats.net.pk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study was conducted to investigate the incidence of infectious bronchitis virus (IBV) in commercial broiler and layer flocks in Pakistan. Serum samples from 16 layers and 9 broiler flocks were screened against M-41, D-274, D-1466, and 4-91 strain antigens using hemagglutination inhibition assay. Overall, 88% of the flocks were seropositive for M-41 antibodies, whereas 40, 52, and 8% of the flocks were positive for D-274, D-1466, and 4-91 IBV strains, respectively. The M-41 antigen was also detected in lungs and tracheal tissues of the clinically positive infectious bronchitis cases. Phospholipase C treatment of the lung and tracheal tissue homogenates from IBV-positive chickens increased the detection limit for M-41 strain from 1.3% positive samples in simple hemagglutination assay to 30.6% positivity when the same samples were treated with phospholipase C. Similarly, reverse transcription-PCR was a much better M-41 detection tool as compared with the classical agar gel precipitation assay utilized to screen tissue homogenates from IBV-positive chickens. In conclusion, this survey clearly demonstrates that several strains of IBV are prevalent in poultry flocks in Pakistan. By utilizing such diagnostic techniques it is possible to conduct a detailed epidemiological study to determine the full economic impact of this disease.

Key Words: chicken • infectious bronchitis virus • Pakistan


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Infectious bronchitis is an acute, highly contagious viral respiratory disease of chickens characterized by tracheal rales, coughing, and sneezing. In addition, the disease may affect kidneys, and in laying flocks there is usually a drop in egg production and egg quality. Mortality may occur in young chicks due to respiratory or kidney manifestations of the infection (reviewed by Cavanagh and Naqi, 1997). The respiratory infection is usually mild and self-limiting in chickens. However, the economic importance of the disease is often complicated by infectious bronchitis virus (IBV) strains that cause kidney and oviduct damage as well as by secondary bacterial infection. The IBV, which belongs to the Coronaviridae family, causes the disease. It is an enveloped virus with a diameter of 120 nm (Davies and Macnaughton, 1979). The disease is prevalent worldwide with significant economic consequences. Although effective vaccines are available and utilized routinely in commercial poultry production, the virus has a tendency of frequent mutations (Wang et al., 1993). There are more than 20 known serotypes within IBV recognized worldwide (Lee and Jackwood, 2000).

The poultry industry in Pakistan is facing severe economic losses due to IBV in layers and broilers. The drop in egg production in layers and mortality due to direct IBV or due to secondary complications contribute significantly toward such losses to the poultry producers in Pakistan (Muneer et al., 1987). The disease is prevalent in broilers and layers. However, few reports have attempted to document the incidence or economic losses in real monetary value. Although, the flocks in Pakistan are routinely vaccinated with Massachusetts-41 (M-41) strain of IBV, the problem still exists and the disease prevalence is routinely observed in vaccinated flocks (unpublished data). Interestingly, the highest antibody titers in nonvaccinated flocks (8.7%) are those against M-41 strain as well (Muneer et al., 1987), thereby suggesting the presence of this and possibly other IBV strains in Pakistan. In a sero-surveillance study, Muneer et al. (1987) found antibodies against Arkansas (2.6%) and Connecticut (2.2%) type IBV as well no antibodies against JMK IBV variant. There are age and seasonal associations with the IBV infections reported in Pakistani flocks (Javed et al., 1991). For example, the disease is more prevalent in 7 d to 5 wk of age, and the incidence is the highest (~67%) in the winter (Javed et al., 1991). Despite very limited reports available on the incidence and severity of infectious bronchitis in Pakistan, this is a serious problem that needs to be investigated and documented.

The current study was therefore designed to investigate the incidence of IBV in commercial broiler and layer flocks of poultry using sero-monitoring of these flocks against M-41 as well as other IBV strains not previously documented in chickens in Pakistan.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chicken Flocks: Source, Husbandry, and Sampling

This study was carried out on commercial chickens. The first source of chickens was commercial flocks located generally in the north and midwest regions (Abbotabad, Manshera, Murree, Hafizabad, Arifwala, and Rawalpindi) of Pakistan. A total of 25 chicken flocks consisting of 16 layer and 9 broiler flocks from these areas were included in this study. The layer flocks were of varying ages ranging from 12 to 50 wk of age, whereas the broiler flocks ranged from 23 to 48 d of age. All flocks were recorded as being free from any apparent clinical disease. Vaccination history included all flocks vaccinated against the M-41 strain of IBV. These flocks served as a source of blood samples used in the serosurveillance study for the presence of various strains of IBV in these flocks. Twenty blood samples were collected from each of the 25 flocks. The samples were transported to the laboratory and the serum phase was collected and stored at –20°C for further analysis.

The second source of chickens used in these studies was the chickens brought to the Poultry Disease Diagnosis Laboratory, Rawalpindi, Pakistan, by commercial farmers. These chickens (n = 150) of varying ages were brought as suspect bronchitis cases from flocks exhibiting respiratory distress. These chickens were necropsied, and lungs and trachea were collected aseptically for tissue analysis and homogenate preparation.

Serological Analysis for IBV Monitoring

Blood samples collected from the first group of chickens (i.e., 25 chicken flocks, 20 blood samples per flock) were collected from cephalic (wing) vein using a 3-cc disposable syringe (Master, Karachi, Pakistan). The serum was used to monitor the flock’s status for the prevalence of various IBV strains. Specific viral antigens for 4 IBV strains [i.e., M-41 (a US strain), D-274 (a Dutch field isolate), D-1466, and 4-91 (European vaccine strains; Cook et al., 1996; Lee and Jackwood, 2001; Callison et al., 2001)], along with their positive control sera were obtained from Gezondheidsdienst voor Dieren B.V. (GD), Animal Health Service, Deventer, the Netherlands. All of these antigens were first tested by hemagglutination to determine the working antigen dilution for their subsequent use in the hemagglutination inhibition (HI) assay. This was done as follows.

Hemagglutination Test

Two-fold serial dilutions of all 4 IBV antigens were prepared in round-bottom 96-well microtiter plates. This was done by adding 50 µL of the test antigen in a well containing 50 µL of PBS (NaCl 4.25 g, Na2PO4 0.66 g, NaH2PO4 0.11 g, deionized distilled water up to 500 mL, pH adjusted to 7.2). The test antigens were 2-fold serially diluted to 1:4,096. Microtiter wells without antigens were also included in each plate for negative controls. To the diluted wells, 50 µL of 0.5% of chicken red blood cells (obtained from apparently disease-free in-house chickens) prepared in 0.1 M PBS were added. The plates were agitated to ensure the even mixing of the well contents. The plates were then incubated at room temperature for 25 min, and the hemagglutination endpoint was recorded. The hemagglutination unit was defined as the reciprocal of the highest dilution of the virus that caused complete agglutination with an equal volume of appropriately diluted red blood cells. This endpoint was obtained for each of the viral antigen and was termed as 1 hemagglutination (HA) unit. Based on the 1-HA unit information, the 4-HA values for each viral antigens were calculated. The 4-HA unit for each viral antigen was a given dilution that was a dilution in the fourth-well lower than the 1-HA unit where the last HA was observed.

Hemagglutination Inhibition Test

Hemagglutination inhibition assay was used to assess the seroprevalence of IBV viral antigens in the serum samples as previously described (Beard, 1970). Briefly, the serum samples were added in 96-well round bottom microtiter plates. The first working dilution for all serum samples was made as 1:5 in PBS in the first well, followed by a 2-fold serial dilution up to the last well in each column. To each well, 25 µL of 4-HA units of IBV antigen as determined previously was added. The plates were incubated at 37°C for 30 to 40 min. After this incubation period, 50 µL of 0.5% chicken red blood cell suspension (diluted in PBS) was added into each well. The plate was agitated to ensure proper mixing of the well contents and reincubated at room temperature for up to 30 to 45 min or until a clean pattern of hemagglutination or HI (button formation) was observed. The maximum dilution of each serum sample causing inhibition of hemagglutination was used as the endpoint. The HI titer of each serum sample was expressed as reciprocal of the serum dilution (top to bottom). The results of HI titer of all the sera thus obtained were subjected to statistical analysis.

Statistical Analysis of the Titers

The geometric mean titer (GMT) was calculated as by taking an average of well numbers showing HI activity from all serum samples within 1 flock. This well number average was then cross-checked against GMT values given in the Brug’s table and was then reported as the GMT for a given flock against a particular IBV antigen.

Detection of IBV Antigens in Clinically Suspect Chickens

Tissue Analysis. The presence of M-41 IBV antigens as evidence of IBV prevalence in commercial chickens was examined. The M-41 strain was used as a representative of the IBV prevalence because the initial seroprevalence studies indicated that the highest incidence of IBV strains in commercial chicken population was of that of M-41 IBV strain (layers = 100% and broilers = 67%; overall = 88%, Table 1Go). To accomplish this, the trachea and lungs were collected aseptically from chickens submitted to the diagnostic laboratory as suspect cases of infectious bronchitis. The frozen tissue blocks made in optimal cutting temperature (EMS, Hatfield, PA) embedding media were sectioned at 4 µm, air-dried on slides, fixed in ice-cold acetone (–20°C) for 10 min, and the slides were stored at –20°C until tested for indirect immunofluorescence (IFA).


View this table:
[in this window]
[in a new window]

 
Table 1. Seroprevalence of infectious bronchitis virus variants in commercial chicken flocks vaccinated with Massachusetts-41 (M-41) strain of infectious bronchitis virus1
 
Reagents and Standardization for Indirect Immunofluorescence Assay

The working dilution of the antiM-41 hyperimmune antibodies and the fluorescein isothiocynate (FITC)-labeled secondary (rabbit antichicken IgG, H&L, FITC-labeled, Sigma) antibody was established in a preliminary trial. Specific pathogen-free chicks (SPF, Vety Care, Intervet, Islamabad, Pakistan) were inoculated with IBV intrana-sally at a dose of 108 embryo infectious dose 50. Two SPF chicks were kept as negative control. At 48 h postinoculation, the chicks were processed and stained with a 1:20 dilution of anti-IBV M-41 serum and a 1:400 dilution of FITC. The best combination of antisera (1:10) and conjugate (1:200) was selected on the basis of acceptable amount of background fluorescence of conjugate and prominent tissue structures.

Indirect Immunofluorescence Assay

Lung and tracheal sections mounted on glass slides were flooded uniformly onto the tissue section area with 10 µL of 1:10 diluted IBV hyperimmune serum. The slides were incubated in a humidified chamber at 37°C for about 30 to 40 min, washed, air dried, and 25 µL of 1:200 dilution of rabbit antichicken FITC-conjugated secondary antibody (IgG H&L) was added over the tissue section area and the slides reincubated at 37°C for another 30 to 40 min. After final washing, a drop of mounting media [equal volumes of PBS (pH 8.5):5% glycerol, adjusted pH 8.5] was added to the section area, and a glass coverslip was mounted on the section. The stained slides were refrigerated until viewing under a fluorescent microscope. The presence of fluorescence in the nucleus or cytoplasm, or both, of cells was considered as an indicator of a particular section being positive for IBV antigen. Representative samples from each tissue type were also sham-treated with serum samples from control chicks to gauge the background level of fluorescence. A dull fluorescence usually associated with nonspecific FITC binding was visually considered as nonspecific and was taken into consideration relative to the test sample results.

Preparation of Tissue Homogenate

Infectious bronchitis virus antigen-positive tracheae and lungs (n = 75) as determined by the IFA test were used for the preparation of tissue homogenates for use in subsequent analysis. After freezing and thawing 3 times to release viruses from the cells, the preparation was centrifuged at 1,500 rpm for 15 min at 10°C. The supernatant was collected and pellet discarded. Finally, the supernatant was filtered through a 0.2-µm filter, and the filtrate obtained was stored in aliquots of 2 mL at –20°C until used.

Detection of IBV in Tissue Homogenates

The tissue homogenates supernatants were tested for viral activity (presence) using direct HA, HA after treatment with phospholipase C, agar gel precipitation test (AGPT), and reverse transcription-PCR (RT-PCR). The HA test was performed as described in the earlier section. The supernatants were diluted in 2-fold dilutions and tested against chicken erythrocytes for direct HA activity. To examine the effects of enzymatic pretreatment on IBV HA activity present in the tissue homogenates, the homogenates were treated with phospholipase-C type 1 from Clostridium perfringens (P7633, Sigma-Aldrich, Lahore, Pakistan) as described by Soula and Moreau (1981). This was done by incubating 500 µL of tissue supernatants with 2 mL of 1 M solution of Tris-HCl buffer (121.1 g of Tris base up to 1 L of double-distilled deionized water, pH adjusted to 6.5). After mixing, the samples were placed on an ice bath. Phospholipase-C type 1 enzyme was thawed, and 35 µL containing 5 enzyme units was immediately added to the homogenate supernatant-Tris HCl suspension. The samples were then placed in a water bath at 37°C for 2 h. These treated supernatants were then tested for HA activity to see any change from the HA activity observed by using the direct HA test method.

Agar Gel Precipitation Test

Agar gel precipitation test used in this study was according to a previously described method (Crowle, 1973). To the central well, 30 µL of known IBV antisera (anti-M-41) was added, whereas in the peripheral wells 30 µL of test antigen (supernatant samples) was added. The plates were incubated at 37°C for 48 h in humidified chamber to avoid drying. The results were recorded after 24 to 48 h by observing the plates against an illuminated light source with a dark background. A white precipitin line between the antigen-antibody wells was considered as a positive result.

Detection of M-41 IBV in Tissue Homogenate Supernatants by RT-PCR RNA Extraction

The RT-PCR test was performed on supernatant samples against M-41 IBV strain. For RNA extraction from the homogenate supernatants, the samples (3 mL) were centrifuged at 5,770 x g for 5 min and the supernatants collected for RNA extraction. To this sample, 200 µL of diethylpyrocarbonate-treated water was added. Then, 600 µL of Trizol LS reagent was added, mixed by repeated pipetting, and incubated for 5 min at room temperature. At this point, 200 µL of chloroform was added and mixed by hand. This mixture was then incubated for 10 min at room temperature and then centrifuged at 7,530 x g at 4°C for 5 to 8 min. The supernatant fractions were collected into new micro centrifuge tubes. At this point, 300 µL of isopropyl alcohol was added and the reactions incubated at room temperature for 10 min. The preparation was then centrifuged at 14,000 rpm for 10 min. The supernatant was discarded, and 500 µL of 70% alcohol was added but not mixed. Tubes were then centrifuged at 14,000 rpm for 5 to 8 min. The supernatant was discarded, and the samples were air-dried under a hood. The resulting pellets were suspended in 20 µL of diethylpyrocarbonate-treated distilled water, incubated at 37°C for 20 min, and then kept at –20°C. The extracted RNA was later quantified by spectrophotometry (RS 232C, Eppendorf, Hamburg, Germany).

RT-PCR Protocol

A 1-step RT-PCR protocol was used by employing cMaster RT Kit (Eppendorf) and following the manufacturer’s instructions. Briefly, a master mixture containing the primers [IBV (forward) CATAACTAACATAAGGGCA, and IBV (reverse) TGAAAACTGAACAAAAGACA; Huang et al., 2004], dNTP, RTplus, PCR buffer, and the enzymes was prepared following the manufacturer’s instructions and kept on ice. The template RNA (1 pg) was added into each reaction sample individually, and the final reaction volume was adjusted with RNase-free water. A master mixture was prepared as described by the kit vendor (Eppendorf) for each reaction depending on the number of samples to be tested. The reaction was placed in a thermal cycler (Master Cycler, Eppendorf), equilibrated at the appropriate incubation temperature of the RT-PCR reaction program parameters, and the desired 1-step RT-PCR program was initiated. The amplified RT-PCR products were run on 0.8% agarose gel in 1x Tris borate following Davis et al., (1994) and Sambrook et al., (1989). A total of 12 µL of the PCR product (10 µL of RT-PCR product plus 2 µL loading dye), molecular weight marker, IBV RNA as positive control, and a normal cell (SPF chicken embryo fibroblast) RNA as negative control were run in parallel. The presence of marker and PCR product bands was visualized with a handheld ultraviolet light. The gel was documented with a photograph, and the size of the amplified fragment was compared with the markers.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sero-prevalence of various infectious bronchitis virus variants in commercial layer and broiler flocks is reported in Table 1Go. Infectious bronchitis virus strain M-41 was found to be most prevalent: this strain was present in 100% of layer flocks and in about 67% of broiler flocks with an overall combined incidence of 88% in all flocks tested (Table 1Go). The incidence of D-274 IBV strain was about 43.7% in layers and 33.3% in broiler flocks with an overall percentage of 40% in all flocks tested (Table 1Go). The incidence of IBV D-1466 strain was 50% in layers and 55% in broiler flocks with an overall percentage of 52% in all flocks tested (Table 1Go). The incidence of IBV 4-91 strain was the lowest in which only 12.5% of the layer flocks tested were found to be sero-positive for strain 4-91. None of the broiler flocks were found to be sero-positive for IBV 4-91 serotype (Table 1Go). The overall flock sero-positivity percentages indicated that the IBV strain M-41 had the highest incidence (88%) out of the 4 serotypes these flocks were tested for. The IBV strains D-274 and D-1466 were of intermediate prevalence in all chicken flocks tested (overall 40% positive for strain D-274 and 52% positive for strain D-1466). The IBV strain 4-91 was found to be of the lowest incidence (8%) among all flocks tested (Table 1Go). The HI titers represented as the GMT were very comparable between the layer and broiler flocks (Table 1Go). Because none of the broiler chicken flocks were positive for IBV strain 4-91, no GMT was observed. When comparing the HI GMT range of 40 to 160 of layers against IBV strain 4-91, it is apparent that some of the strongest HI response (i.e., 160) was observed in the layer flocks against IBV strain 4-91 compared with the rest of the IBV strains (Table 1Go).

The presence of M-41 IBV antigen in lungs and tracheas of IBV-suspected chickens was examined. As shown in Table 2Go, 40% of lungs and 10% of tracheas were detected as positive for the M-41 IBV antigen. These lungs and trachea were pooled and homogenized. The supernatants were then subjected to confirmatory analysis via direct HA test and HA after treatment with phospholipase C enzyme. The results are shown in Table 3Go. Out of a total of 75 IBV-positive samples, only 1 sample was detected positive for M-41 antigen in the direct hemagglutination assay. However, after treatment with the phospholipase C the detection limit for the direct hemagglutination assay increased significantly in that 23 out of 75 samples exhibited positive hemagglutination against M-41 antibody (Table 3Go). Agar gel precipitation test was used as another indicator of the presence of IBV M-41 antigen in the tissue homogenates. As shown in Table 4Go, only 4 out of 75 samples (5.3%) were found positive against M-41 antibody in the agar gel precipitation assay. The RT-PCR assay revealed significantly higher numbers of positive samples (43 out of 75; 57.3%) with a 1,700-bp product as shown in Table 4Go. Figure 1Go represents an example of RT-PCR positive samples in lanes 4 through 8. Lane 2 represents the positive control in which an M-41 vaccine strain of IBV was amplified using the same IBV primer sets. The position of PCR products for the M-41 IBV strain in homogenate samples is shown by an arrow and was determined to be around 1,700 bp.


View this table:
[in this window]
[in a new window]

 
Table 2. The detection of Massachusetts-41 infectious bronchitis virus (IBV) strain in organs from commercial chickens submitted to the diagnostic laboratory as infectious bronchitis-suspect cases1
 

View this table:
[in this window]
[in a new window]

 
Table 3. The detection of M-41 strain of infectious bronchitis virus (IBV) in homogenates from organs of IBV-positive commercial chickens1
 

View this table:
[in this window]
[in a new window]

 
Table 4. The detection of M-41 strain of infectious bronchitis virus (IBV) in homogenates from organs of IBV positive commercial chickens1
 

Figure 1
View larger version (63K):
[in this window]
[in a new window]

 
Figure 1. An example of reverse transcription-PCR (RT-PCR) product of S1 gene of the infectious bronchitis virus (IBV) from tissue homogenate. Lane 1 = known marker ladder; lane 2 = known IBV Massachusetts-41 (M-41) amplified fragment as positive control; lane 3 = IBV negative control; lanes 4 to 8 show positive bands of 1,700 bp.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The present study was conducted to monitor the incidence of infectious bronchitis in commercial chickens in Pakistan. This disease is of significant economic concern for poultry producers in Pakistan (Muneer et al., 1987) and around the globe (De Wit, 2000). The causative agent of the disease IBV is prevalent worldwide, and in all countries with an intensive poultry industry, the incidence of infection approaches 100% in most locations (Ignjatovic and Sapats, 2000). There is limited evidence in the literature describing the prevalence of poultry disease in Pakistan. One report describes the analysis of 900 serum samples from 23 flocks in Pakistan and reported an incidence of 3 strains of IBV (M-41, Arkansas, Connecticut) in Pakistan (Muneer et al., 1987). Therefore, the current study attempted to monitor IBV variants in commercial chicken flocks, with particular emphasis on strains not reported before in Pakistan (i.e., D-274, D-1466, and 4-91).

As is the case with most viruses, the IBV virus also has multiple serotypes. More than 20 serotypes within IBV have been recognized worldwide (Lee and Jackwood, 2000). These new strains arise due to rapid recombination, insertions, deletions, or point mutation events, predominantly in the S1 (the spike protein gene) gene resulting in the generation of Massachusetts-like and Arkansas-like IBV strains (Wang et al., 1993). The commercial chicken flocks included in our study were vaccinated with the M-41 IBV strain, a common practice to vaccinate against IBV in Pakistan. This is based on the fact that M-41 strain is known to be most prevalent IBV strain in Pakistan (Muneer et al., 1987). Our study showed that layer and broiler flocks exhibited the presence of IBV with most flocks showing seroconversion against M-41. This was expected because the flocks used in the current study had vaccination history against M-41 IBV strain. Surprisingly, not all broiler flocks were positive for M-41. The 3 out of 9 negative M-41 flocks (Table 1Go) might have been poor immune responders or perhaps (more than likely) due to vaccine failure. It is interesting to note that 3 previously not reported strains of IBV (i.e., D-274, D-1466, and 4-91) in Pakistan were clearly shown to be present (i.e., seropositive) in layers and broilers as documented in this study. Two additional IBV variants were also detected subsequent to this study. These included D-8888 and D-386 variants (data not shown). These observations suggest that there is a possibility of the presence of several other IBV strains in Pakistan.

Rabbit antisera prepared against avian M-41infectious bronchitis virus is known to have cross reactive antibodies against other IBV strains such as T, Holte, Connecticut, Beaudette, or H120 (Collins and Alexander, 1987). Although absorption of concentrated M-41 with various IBV strains removes almost all cross reactivity, the resulting IBV M-41 antisera still maintains multiple precipitin lines suggesting significant antigen heterogeneity. This may be one of the reasons why several flocks even though vaccinated with M-41 exhibited significant levels of detectable antibodies (as measured by the HI assay) against D-274, D-1466, and 4-91 IBV strains (Table 1Go). However, it is most likely that the flocks used in this study were also exposed naturally to various IBV variants under commercial management practices. What is surprising is the fact that the levels of antibodies (reported as GMT range; Table 1Go) against nonM-41 strains were also very high. However, none of the flocks under our sero-monitoring study exhibited any IBV-representative clinical signs. It is well recognized that the outbreaks of infectious bronchitis in vaccinated flocks occur quite frequently, perhaps due to inappropriate vaccination or rapid emergence of new strains (Smati et al., 2002). In addition, the environmental factors (such as heat, mycotoxins, etc.) that can induce significant stress on birds have the potential to make chickens immunosuppressed (Dietert et al., 1985; Miller and Qureshi, 1991, 1992a, Miller and Qureshi, b; Neldon-Ortiz and Qureshi, 1991; Qureshi and Hagler, 1992), thereby increasing the chances of viral infections.

The poultry producers seek assistance for disease diagnosis through a limited network of poultry diagnostic laboratories. Birds clinically suspect for IBV are routinely received in these laboratories. We utilized some of these birds to monitor the prevalence of the M-41 serotype. This is because M-41 is considered to be the most prevalent IBV strain in commercial chickens. We found that indirect IFA can be of good value to assess the level of IBV involvement and presence in various tissues of the suspect birds. The IFA has been shown to be of value in detecting IBV antigen in infected chicken kidney cells and tracheal smears (Yagyu and Ohta, 1990). In our study we found that IBV antigen can be detected via IFA in lungs and trachea. Not all organs tested were found positive, and it was not possible to clearly associate the presence (or absence) of IBV antigen with the observance of clinical signs of infectious bronchitis. We did not test kidneys and cecal tonsils for IBV antigen. The limiting factor in this decision was the limited supply of our IFA reagents. What was interesting was that the M-41 antigen was much more readily detectable in lungs than in the tracheal samples (Table 2Go). The question to be asked is whether this is because the infectious bronchitis virus immediately translocates to the lungs and uses it as a preferential site of replication or these samples were collected at a stage of infection that was more chronic. One would expect that tracheal tissue will harbor a significant amount of the virus by being the source of entry through the upper respiratory tract. Nevertheless, one could argue that with improved diagnostic technologies such as RT-PCR the incidence reported based on detection by nonmolecular techniques may be vastly different. This is supported by our own study that only 4 out of 71 samples were found positive for M-41 antigen by using the agar gel precipitation assay (Table 4Go) where as out of the same samples the positive percentage increased from 5.3 to 57.3% when the RT-PCR technique was used (Table 4Go).

There are several commonly used methods for IBV detection, namely HA (Lashgari and Newman, 1984), hemagglutination inhibition (King and Hopkins, 1983), AGPT (Lohr, 1980, 1981), and RT-PCR (Kwon et al., 1993). In our study, the detection limit of HA assay increased with phospholipase C enzyme treatment of test samples, presumably by exposing (and dissolving the spike protein S1) the proteins responsible for hemagglutination of erythrocytes (Lashgari and Newman, 1984). The agar gel precipitation was not very sensitive for detecting IBV from tissue homogenates. However, the RT-PCR was most sensitive. These experiments clearly indicate that pretreatment with phospholipase C and then doing an HA or HI test will be most cost effective and practically applicable under the diagnostic conditions in Pakistan. However, if RT-PCR can be established as a routine diagnostic test, it would by far be the most sensitive diagnostic assay. Although RT-PCR may not be a field-friendly diagnostic test, it certainly would be a very reliable tool in accurately estimating the epidemiological incidence of infectious bronchitis in Pakistan. Although the primer set used for RT-PCR experiment was supposedly M-41 IBV strain specific, there always is a possibility that such a primer set may serve possibly as a universal primer set, thereby detecting IBV strains other than M-41 as well. It is therefore imperative that the findings of the current study be considered in the light of such a cross-reactive possibility.

In conclusion, the current study presents evidence that IBV variants are prevalent in various meat and egg-type commercial chickens in Pakistan. The incidence of the disease is not well documented because there is no such mechanism at the national level. This might present a huge challenge in itself because the poultry industry in Pakistan is not well integrated. In addition to a select few operations that can be considered large-scale, there are numerous family or backyard poultry production operations, which never enter into any statistics. Furthermore, the animal health, disease surveillance, guidelines for vaccination, and so on, are not mandated or are not well overseen. This may present even a larger concern considering the recent outbreaks of avian influenza worldwide. One factor that may ensure a reduction in the incidence of IBV could be strict enforcement of vaccination of all poultry flocks. Along with vaccination, it is imperative to continuously monitor the existence of various serotypes so that the vaccines used can be customized depending upon the prevalence of particular serotypes in a given geographical area. There is an increasing tendency by the poultry and livestock producers to import vaccines from other countries. Although this may work in cases where the antigenic stability of the vaccine strain is unquestionable, one would expect that the prevalence of a particular disease-causing strain may be variable across the world or even within one particular country or geographical area.

Received for publication November 17, 2006. Accepted for publication March 9, 2007.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Beard, C. W. 1970. Demonstration of type specific antibody in mammalian and avian sera by immunodiffusion. Bull. World Health Org. 42:779–785.[Web of Science][Medline]

Callison, S. A., M. W. Jackwood, and D. A. Hilt. 2001. Molecular characterization of infectious bronchitis virus isolates foreign to the United States and comparison with United States isolates. Avian Dis. 45:492–499.[Web of Science][Medline]

Cavanagh, D., and S. A. Naqi. 1997. Infectious bronchitis. Pages 511–526 in Diseases of Poultry, 10th ed. Iowa State Univ. Press, Ames.

Collins, M. S., and D. J. Alexander. 1987. Strain specific antibodies revealed by immuno absorption studies with avian infectious bronchitis virus. Vet. Res. Commun. 11:109–118.[Medline]

Cook, J. K., S. J. Orbell, M. A. Woods, and M. B. Huggins. 1996. A survey of the presence of a new infectious bronchitis virus designated 4/91 (793B). Vet. Rec. 138:178–180.[Abstract/Free Full Text]

Crowle, A. J. 1973. Immunodiffusion. 2nd ed. Acad. Press, New York, NY.

Davies, H. A., and M. R. Macnaughton. 1979. Comparison of the morphology of three corona viruses. Arch. Virol. 59:25–33.[Web of Science][Medline]

Davis, L. G., W. M. Kuehl, and J. F. Batty. 1994. Pages 159–161 in Basic Methods in Molecular Biology. 2nd ed. Appleton and Lange, East Norwalk, CT.

De Wit, J. J. 2000. Detection of infectious bronchitis virus. Avian Pathol. 29:71–93.[Medline]

Dietert, R. R., M. A. Qureshi, U. C. Nanna, and S. E. Bloom. 1985. Embryonic exposure to aflatoxin-B1: Mutagenicity and influence on development and immunity. Environ. Mutagen. 7:715–725.[Web of Science][Medline]

Huang, Y. P., Lee, H. C., Cheng, M. C., and Wand, C. H. 2004. S1 and N gene analysis of avian infectious bronchitis viruses in Taiwan. Avian. Dis. 48:581–589.[Web of Science][Medline]

Ignjatovic, J., and S. Sapats. 2000. Avian infectious bronchitis virus. Rev. Sci. Tech. 19:493–508.[Web of Science][Medline]

Javed, T., M. Siddique, and A. Hameed. 1991. Persistence and morpho-pathological studies on infectious bronchitis in chickens in Pakistan. Assiut Vet. Med. J. 25:216–228.

King, D. J., and S. R. Hopkins. 1983. Evaluation of the haemagglutination inhibition test for measuring the responses of chickens to avian infectious bronchitis virus vaccination. Avian Dis. 27:100–112.[Web of Science][Medline]

Kwon, H. M., M. W. Jackwood, and J. Gelb, Jr. 1993. Differentiation of infectious bronchitis virus using the polymerase chain reaction and restriction fragment length polymorphism analysis. Avian Dis. 37:194–202.[Web of Science][Medline]

Lashgari, M. S., and J. A. Newman. 1984. Serological comparison and antigenic relationships of seven serotypes of infectious bronchitis virus using haemagglutination inhibition test. Avian Dis. 28:435–443.[Web of Science][Medline]

Lee, C.-W., and M. W. Jackwood. 2000. Evidence of genetic diversity generated by recombination among avian coronavirus IBV. Arch. Virol. 145:2135–2148.[Web of Science][Medline]

Lee, C.-W., and M. W. Jackwood. 2001. Spike gene analysis of the DE072 strain of infectious bronchitis virus: Origin and evolution. Virus Gene 22:85–91.[Web of Science][Medline]

Lohr, J. E. 1980. Infectious bronchitis agar gel precipitation test—Use of infected allantoic fluid as antigen. Avian Dis. 24:463–467.[Web of Science][Medline]

Lohr, J. E. 1981. Diagnosis of infectious bronchitis (IB) by examination of tracheal mucous for IB-precipitating antigens. Avian Dis. 25:1058–1064.[Web of Science][Medline]

Miller, L., and M. A. Qureshi. 1991. Induction of heat-shock proteins and phagocytic function of chicken macrophage following in vitro heat exposure. Vet. Immunol. Immunopathol. 30:179–191.[Web of Science]

Miller, L., and M. A. Qureshi. 1992a. Comparison of heat-shock-induced and lipopolysaccharide-induced protein changes and tumoricidal activity in a chicken mononuclear cell line. Poult. Sci. 71:979–987.[Web of Science][Medline]

Miller, L., and M. A. Qureshi. 1992b. Molecular changes associated with heat-shock treatment in avian mononuclear and lymphoid lineage cells. Poult. Sci. 71:473–481.[Web of Science][Medline]

Muneer, M. A., J. A. Newman, S. M. Goyal, and M. Ajmal. 1987. Antibodies to avian infectious bronchitis virus in Pakistani chickens. Poult. Sci. 66:765–767.[Web of Science][Medline]

Neldon-Ortiz, D. L., and M. A. Qureshi. 1991. Direct and microsomal activated aflatoxin B1 exposure and its effects on turkey peritoneal macrophage functions in vitro. Toxicol. Appl. Pharmacol. 109:432–442.[Web of Science][Medline]

Qureshi, M. A., and W. M. Hagler Jr. 1992. Effect of fumonisin-B1 exposure on chicken macrophage functions in vitro. Poult. Sci. 71:104–112.[Web of Science][Medline]

Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning, a Laboratory Manual, 2nd ed. Cold Spring Harbor Lab. Press, Cold Spring, NY.

Smati, R., A. Silim, C. Guertin, M. Henrichon, M. Marandi, M. Arella, and A. Mersouki. 2002. Molecular characterization of three new avian infectious bronchitis virus (IBV) strains isolated in Quebec. Virus Genes 25:85–93.[Web of Science][Medline]

Soula, A., and Y. Moreau. 1981. Antigen requirements and specificity of a microplate enzyme-linked immunosorbent assay (ELISA) for detecting infectious bronchitis viral antibodies in chicken serum. Arch. Virol. 67:283–295.[Web of Science][Medline]

Wang, L., D. Junker, and E. W. Collisson. 1993. Evidence of natural recombination within the S1 gene of infectious bronchitis virus. Virology 192:710–716.[Web of Science][Medline]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ahmed, Z.
Right arrow Articles by Hameed, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ahmed, Z.
Right arrow Articles by Hameed, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS