| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
IMMUNOLOGY, HEALTH AND DISEASE |
(HIF-1), and Heat-Shock Proteins in Tibial DyschondroplasiaInstitute of Animal Sciences, Volcani Center, Bet Dagan 50250, Israel
1 Corresponding author: pines{at}agri.huji.ac.il
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
(HIF-1), the major regulator of the hypoxic response that is essential for chondrogenesis, and that of heat-shock proteins (Hsp) downstream from HIF-1. We demonstrated that, in contrast to the normal growth plates, those afflicted by TD were hypoxic. A major increase in hypoxia was observed in the proliferative, hypertrophic, and calcified zones. In the normal growth plate, HIF-1 was expressed in chondrocytes of the articular cartilage and of the maturation zone, whereas in cases of TD, HIF-1 was also expressed in chondrocytes below the lesion. The expression level of HIF-1 was related to the severity of the disease, but was independent of its cause; the same pattern of expression was observed in growth plates of chicks selected for a high incidence of TD. No differentiation-dependent expression of HIF-1 was observed in response to hypoxia, as demonstrated by the use of primary cultures of growth plate chondrocytes. In the normal growth plates, Hsp90 and Hsp70 were localized to the maturation zone. More cells expressed both Hsp in the TD lesion. In conclusion, we demonstrated that the TD growth plate, in contrast to the normal one, is hypoxic, probably because of the lack of vascularization. Hypoxia leads to an increase in the transcription factor HIF-1, causing increases in the levels of Hsp90 and Hsp70.
Key Words: heat-shock protein • alkaline phosphatase • chondrocyte • growth plate
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Tibial dyschondroplasia is a disease of the growth plates, which are located at the ends of the long bones (Farquharson and Jefferies, 2000; Pines et al., 2005), and is characterized by the appearance of a mass of unvascularized, unmineralized, white opaque cartilage that dominates the proximal metaphysis of the tibiatarsus and occasionally the tarsometatarsus (Hargest et al., 1985). During the process of longitudinal bone growth, from the proliferative stage through the hypertrophic to the degenerative stage, chondrocytes within the growth plate differentiate in a proximal to distal direction (Howlett, 1979; Pines and Hurwitz, 1991). The process begins with the division of the cells at the top of each column, to produce the cells of the proliferative zone (PZ). These proliferative chondrocytes divide, with the highest rate of division occurring in the middle of the PZ. At some stage, for unknown reasons, the cells cease to divide and undergo extensive hypertrophy. Finally, apoptosis occurs (Hatori et al., 1995; Wang et al., 2002) and the cartilaginous matrix is replaced with osteoblasts and bone matrix (Farquharson and Jefferies, 2000). The various morphological and biochemical manifestations of the TD lesion, such as changes in carbonic anhydrase (Gay et al., 1985), alkaline phosphatase (AP) activity, production of collagen types II and X, and osteopontin synthesis (Pines et al., 1998), suggest that TD chondrocytes fail to undergo the complete differentiation that normally leads to cartilage vascularization and mineralization (Praul et al., 2000; Pines et al., 2005).
Vascularization is a key mechanism for the coupling of 2 fundamental processes in the growth plate that determine the rate of bone growth: chondrogenesis (cartilage production) and osteogenesis (bone formation). Precise coupling is crucial during periods of rapid bone growth, and changes in the balance might induce pathological conditions. During the formation of the growth plates of long bones, there is a close and dynamic interaction between developing vascular structures and the cartilage. In comparison with the mammalian growth plate, the avian growth plate contains much longer columns of cells, which become randomly oriented, and more cells are found in each zone of the growth plate (Pines et al., 2005). In addition, the metaphyseal blood vessels in the avian growth plate penetrate more deeply (Leach and Gay, 1987; Pines and Hurwitz, 1991) to ensure proper oxygen transfer to the chondrocytes. The TD lesion is avascular (Gay et al., 2007) and its cartilage is more resistant to blood vessel penetration (Haynes and Walser, 1982). Moreover, chickens selected for a high incidence of TD exhibited fewer vascular tunnels in the hypertrophic zone (HZ) than did normal chickens (Riddell, 1977). Among the possible consequences of lack of vascularization in the TD lesion are low oxygen tension and hypoxia, which lead to insufficient cellular energy production. During mammalian fetal development, there is a gradient of oxygenation in the cartilaginous growth plate, and the hypoxia is essential for cartilage differentiation and endochondral bone formation (Schipani et al., 2001; Schipani, 2005). In the normal chick growth plate, although an oxygen-related gradient was observed in the differentiation of cells within the growth plate, no hypoxia was detected and the oxygen status of the cells throughout the cartilage was consistent with their oxygen needs (Shapiro et al., 1997). The primary effectors of the adaptive response of the chondrocytes to hypoxia are the hypoxia-inducible factor (HIF) family of transcription regulators (Schipani, 2005). These proteins activate the expression of a broad range of genes that mediate many of the responses to decreased oxygen concentration, including enhanced glucose uptake, increased red blood cell production, and the formation of new blood vessels via angiogenesis (Hickey and Simon, 2006). Hypoxia-inducible factor-1 is the major regulator of the hypoxic responses that are essential for chondrogenesis, such as chondrocyte growth arrest, survival, maturation, and apoptosis (Schipani et al., 2001; Bohensky et al., 2007; Provot and Schipani, 2007; Terkhorn et al., 2007). Among the genes that are regulated via the HIF-1 pathway during hypoxia are the highly conserved heat-shock proteins (Hsp), which are known to act as cellular chaperones for proteins that are misfolded by cellular stresses. These genes are critical for adaptation to low oxygen levels and for withstanding the oxidative stress of reoxygenation (Baird et al., 2006). Previously, we demonstrated that early changes in incubation temperature that were associated with increased incidence of TD caused an increase in the level of Hsp90, especially in differentiated growth plate chondrocytes (Yalcin et al., 2007). Thus, the increase in metabolic activity during exposure to high temperatures may cause oxygen scarcity that would initiate changes in the expression of HIF-1 and various Hsp. We hypothesized that TD lesions are undergoing hypoxia and thereby expressing related gene products. In the present study, we evaluated the hypoxia status of the TD growth plate as related to HIF-1 gene expression and to Hsp synthesis by the normal and TD growth plate chondrocytes.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Dulbecco’s modified Eagle’s medium and trypsin-EDTA solution (0.25 to 0.02%) were obtained from Sigma (St. Louis, MO). Fetal calf serum was obtained from Biochemical Industries (Beth-Haemek, Israel). Chicken Hsp90 and Hsp70 monoclonal antibodies were obtained from Abcam (Cambridge, UK) and Alexis Biochemicals (San Diego, CA), respectively. The Hypoxyprobe-1 (pi-monidazole hydrocloride) kit was obtained from Chemicon International (Temecula, CA). The HIF-1 probe was prepared according to the chicken HIF-1 sequence (accession number NM 204297). For in situ hybridization of HIF-1, a probe of 865 bp (125 to 989; left primer CCGAAGAAGCAAGGAATCAG, and right primer CCAGACGTAGCCACCTTGTT) was prepared with RNA from cobalt-treated cultured avian growth plate chondrocytes. Anti-mouse immunoglobulins conjugated to horseradish peroxidase and 3,3'-diaminobenzidine chromogen were from Dako (Glostrup, Denmark).
Induction of Rickets and TD
Day-old male broiler chicks (Cobb strain) were obtained from commercial hatcheries and raised in battery brooders in constant-temperature rooms at 24°C. The control birds were fed ad libitum diets appropriate for their age and designed to satisfy the recommendations of the NRC (1984). Tibial dyschondroplasia was induced by dietary thiram (25 and 50 ppm) according to the method of Ben-Bassat et al. (1999). In addition, broiler lines selected for high and low incidences of TD were used (Twal et al., 1996). At 10 d of age, the growth plates were removed and HIF-1 was determined by in situ hybridization. For induction of rickets, a vitamin D-deficient diet was prepared as described by Bar et al. (1990). Chicks were fed for 20 d, after which the growth plates were removed for HIF-1 evaluation.
Hypoxia Determination
The chicks were fed from hatch with either a normal diet or a diet containing 50 ppm of thiram. At 7 d of age, the thiram-treated chicks were afflicted with TD with a score of 3 (Pines et al., 2005). All the chicks were injected with Hydroxyprobe-1 at 40 mg/kg into the wing vein, and after 60 min they were sacrificed and the tibiae growth plates were collected. The chemical probe reacts with proteins under hypoxia, leading to the generation of new protein adducts, which can be detected with monoclonal antibodies.
Preparation of Growth Plate Sections, Immunohistochemistry, and In Situ Hybridization
Immediately after the chicks had been sacrificed by cervical dislocation, the tibiae were removed and fixed overnight in 4% paraformaldehyde in PBS at 4°C. Serial 5-µm sections were prepared after the samples had been dehydrated in graded ethanol solutions, cleared in chloroform, and embedded in Paraplast. For hybridization, the sections were deparaffinized in xylene, washed in 100% ethanol, and dried. The sections were washed in 4% para-formaldehyde for 20 min and then in PBS. The sections were then rinsed in distilled water and treated with proteinase K (2 µg/mL in 50 mM Tris-HCl, 5 mM EDTA, pH 7.5) for 20 min. After digestion, the slides were rinsed with distilled water, postfixed in 10% formalin in PBS, blocked in 0.2% glycine, rinsed in distilled water, rapidly dehydrated through graded ethanol solutions, and air-dried for 1 h. Sections were hybridized with UTP-35S HIF-1 probe. In all hybridizations, no signal was observed in response to the sense probe that was used as a control. All the preparations for in situ hybridization within each experiment were performed simultaneously, with the same probe and with the same specific activity, and all sections were dipped in emulsion and exposed for the same length of time. Heat-shock protein 90 and Hsp70 were detected by immunohistochemistry with monoclonal antibodies at a 1:100 dilution. As a second antibody we used goat anti-mouse immunoglobulin conjugated to horseradish peroxidase and 3,3'-diaminobenzidine as a chromogen. No signal was observed without the primary antibody.
Cell Cultures
Avian epiphyseal growth-plate chondrocytes were prepared and cultured as described previously (Pines and et al., 1998). Only early passages (1 to 3) were used. Before the experiments, the cells were detached by incubation with trypsin-EDTA solution, and were plated in Dulbecco’s modified Eagle’s medium containing 5% fetal calf serum. For differentiation, primary chick growth plate chondrocytes were incubated for 3 d with 50 µM ascorbic acid (Halevy et al., 1994). Before the experiment, the medium was replaced with fresh serum-free medium for 3 h, after which the cells were incubated for an additional 18 h with 0.5 mM hypoxia mimetic CoCl2 (Kim et al., 2006). At the end of the incubation period, total RNA was isolated with TRIzol reagent. Complementary DNA was created by reverse transcription-PCR and the level of HIF-1 was evaluated by PCR with HIF-1-specific primers (left: 5'-CCGAAGAAGCAAGGAATCAG-3'; right: 5'-CCAGACGTAGCCACCTTGTT-3'). Alkaline phosphatase activity was evaluated colorimetrically at 410 nm by adding 5 mM p-nitrophenol phosphate, and was expressed as units of p-nitrophenol formed per minute per milligram of protein, as described previously (Monsonego et al., 1997).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Growth plate chondrocytes of a normal 7-d-old chick were not hypoxic, as indicated by the lack of immunostaining of protein adducts after pimonidazole hydrochloride administration (Figure 1
, panel a). No hypoxia was observed in the calcified zone (Figure 1, panel b). In the chicks with thiram-induced TD, a major increase in hypoxia was observed in chondrocytes populating the proliferative, hypertrophic, and calcified zones (Figure 1, panels c, d, and e). In the normal chick, no hypoxic chondrocytes were observed adjacent to the blood vessels (Figure 1, panel f), whereas in the chicks with thiram-induced TD, chondrocytes adjacent to the blood vessels surrounding the lesion were hypoxic (Figure 1, panels g, h, and i).
|
in the TD and Rickets Growth Plates
In a normal growth plate derived from a 7-d-old chick, HIF-1 was expressed in chondrocytes of the articular cartilage and of the lower PZ and upper HZ—the maturation zone (MZ; Figure 2, panels a, b. and c). In the thiram-induced TD, in addition to the cells of the MZ, HIF-1 was expressed by chondrocytes below the TD lesion but not by cells within the lesion (Figure 2, panels d, e , f, and g). Tibial dyschondroplasia was induced by various levels of thiram, and at 10 d of age the level of HIF-1 gene expression by the growth-plate chondrocytes was dependent on the severity of the TD lesions (Figure 3). The pattern of HIF-1 expression was not limited to the thiram-induced TD, because the same pattern was observed in growth plates of 10-d-old chicks selected for a high incidence of TD (Figure 4, panel A). In rickets, another disease of the growth plate, the PZ of 20-d-old chicks was enlarged, and not all the columns populated by chondrocytes expressed this transcription factor (Figure 4, panel B).
|
|
|
by Cultured Avian Growth Plate Chondrocytes
Avian growth plate chondrocytes in culture were in their proliferative state, as suggested by their low AP activity (Figure 5). In response to ascorbic acid, the cells differentiated and exhibited characteristics of hypertrophic chondrocytes, such as very high AP activity. The levels of HIF-1 gene expression were similar in the proliferative and the hypertrophic chondrocytes, and the observed increases in HIF-1 levels in response to cobalt were independent of the differentiation status of the cells.
|
After exposure to environmental insults, the molecular chaperone of the Hsp family participates in preserving the expression and activity of various proteins, including HIF-1. In the normal growth plate, Hsp90 is localized especially to the chondrocytes of the MZ, although some of the chondrocytes of the HZ also exhibit Hsp90 synthesis (Figure 6). In the TD lesion, more cells expressed Hsp90, and a greatly enhanced area was populated with chondrocytes positive for this Hsp. Heat-shock protein 90 was not the only Hsp affected by hypoxia in the TD growth plate; other members of the Hsp family were also affected. In the normal avian growth plate, Hsp70 was localized especially in the MZ and upper HZ. In the TD lesion, more cells synthesized Hsp70, similar to the pattern of Hsp90 synthesis (Figure 7).
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
), and we observed no hypoxia in their growth plates (Figure 1). A major consequence of the lack of vascularization in the TD lesion is insufficient oxygen supply: chondrocytes of the PZ and HZ and those surrounding the blood vessels are exposed to low oxygen levels (Figure 1). It is interesting to note that whereas during the development of the mammalian embryo, the lack of growth plate vascularization, which results in hypoxia, is essential for normal bone development (Schipani et al., 2001; Schipani, 2005), in thiram-treated chicks the hypoxia was associated with a pathological state (Rath et al., 2007).
Hypoxia-inducible factor-1 is one of the major regulators of the hypoxic response (Kaelin, 2002), and its conditioned knockout demonstrated its importance to the survival of hypoxic chondrocytes (Schipani et al., 2001). In the normal 7-d-old chick, the articular chondrocytes and the chondrocytes of the growth plate, especially those of the MZ, expressed the HIF-1 gene (Figure 2), although no hypoxia was observed (Figure 1). In the TD hypoxic growth plate, however, HIF-1 expression appeared normal above the lesion, disappeared in the cartilage mass, and was again expressed below the lesion (Figure 2), as was observed previously for osteopontin and bone sialoprotein (Pines and Hurwitz, 1998). This may suggest that the hypoxia-dependent increase in HIF-1 gene expression is not regulated in the same manner by all growth plate chondrocytes. In the enlarged growth plates of rachitic chicks, only some, but not all, of the columns populated by chondrocytes expressed the HIF-1 gene (Figure 4B). This was probably not due to the differentiation state of the cells, because all the cells in the rachitic growth plate were in the same differentiation state, and in culture, normal growth plate chondrocytes responded to hypoxia with an increase in HIF-1, independently of their differentiation status as reflected by the AP activity (Figure 5). Alkaline phosphatase activity is one of the main indications of chondrocyte differentiation in vitro (Halevy et al., 1994; Monsonego et al., 1997), and in vivo it marks the onset of hypertrophy and calcification (Ben-Bassat et al., 1999; Yalcin et al., 2007).
The increase in HIF-1 gene expression was dependent on the severity of the lesion (Figure 3) but was independent of the cause of TD, as indicated by the observation of the same pattern of expression in the lesions of birds selected for high TD incidence (Figure 4A). Thus, the various protocols used to induce TD may initially act via distinct pathways, but downstream they probably share common pathway(s) that lead to the same phenotype.
In the normal growth plate, a complex of signaling pathways regulates the maturation of the chondrocytes that undergo proliferation, maturation, hypertrophy, mineralization, and programmed cell death. Hypoxia-inducible factor-1 is a major regulator of chondrocyte apoptosis (Bohensky et al., 2007), and chondrocytes deficient in HIF-1 undergo massive cell death exclusively in the hypoxia-affected region (Schipani et al., 2001). In the hypoxic TD lesion, where many of the chondrocytes were previously shown to be apoptotic (Praul et al., 1997; Rath et al., 1998), an increase in HIF-1 gene expression was observed (Figures 2, 3, and 4). This may suggest not only that the regulation of HIF-1 is different, but also that its function may differ between the normal and TD growth plates. Many chondrocytes in large lesions are apoptotic (Praul et al., 1997; Rath et al., 1998), and small lesions contain few or no apoptotic cells. This suggests that the formation of severe TD lesions is not caused by the premature apoptosis of hypertrophic chondrocytes, but rather that apoptosis may be a consequence of a disruption of the normal vascularization of this tissue: as a small developing lesion increases in size, chondrocytes in the center of the lesion become increasingly cut off from the vascular supply, which results in apoptosis (Praul et al., 2000). We cannot exclude the possibility that thiram induces HIF-, which then causes premature apoptosis of chondrocytes, precluding vascularization. These results, together with the observation that the chondrocyte death that follows the lack of HIF-1 does not require hypertrophic differentiation, suggest that chondrocyte death is likely to be different from the chondrocyte apoptosis that precedes blood vessel formation and the cartilage-to-bone transition. Moreover, in the normal growth plate, HIF-1 is a negative regulator of chondrocyte proliferation, but no increase in its expression was observed in rickets, in which increased proliferation of the chondrocytes resulted in enlarged growth plates (Figure 4).
Tibial dyschondroplasia is a disorder that affects broilers (Leach and Lilburn, 1992) and turkeys (Wyers et al., 1991) growing at their maximal genetic potential. Treatments that consistently decrease the incidence of TD are those that restrict growth rates (Huff, 1980; Su et al., 1999). Consistent with these observations is the fact that HIF-1, as well as several of its downstream targets, was found among the growth plate genes that were down-regulated during food restriction and increased during catch-up growth (Even-Zohar et al., 2008).
Many different external and intrinsic apoptotic stimuli, including hypoxia, induce the accumulation of Hsp in the cells. The Hsp have a protective function that enables the cells to survive otherwise lethal conditions (Lanneau et al., 2008). A regulatory link exists between the oxygen-sensing and the heat-shock pathways. This link involves the hypoxia-dependent up-regulation of the heat-shock factor because of the direct binding by HIF-1 that is necessary for full Hsp induction during hypoxia (Baird et al., 2006). Thus, HIF-1 control of heat-shock factor transcriptional levels is a regulatory mechanism for sensitizing heat-shock pathway activity to maximize production of protective molecules. Regulation of HIF-1 also involves interaction with Hsp90, which stabilizes HIF-1 and mediates O2-independent ubiquitination and proteasomal degradation. In the TD lesion, an increase was observed in both Hsp90 and Hsp70 (Figures 5 and 6). Our results cannot answer whether the high Hsp expression in TD preceded or followed abnormal chondrocyte cell death. Heat-shock protein 70, which in the normal avian growth plate is localized especially in the MZ and upper HZ, as has been observed in mammals (Vanmuylder et al., 1997), is known to prevent both caspase-dependent and caspase-independent apoptosis, whereas Hsp90 either facilitates or prevents apoptosis (Parcellier et al., 2003) and is involved in chondrocyte differentiation (Yalcin et al., 2007).
In conclusion, we demonstrated that, in contrast to the normal growth plate, and regardless of the cause of TD, the unvascularized lesion was hypoxic. Because of the hypoxia, transcription factor HIF-1 expression increased, especially in the chondrocytes surrounding the TD lesion. In addition, the levels of members of the Hsp family (Hsp90 and Hsp70) increased in the MZ of the lesion. These results indicate a new target pathway for intervention intended to reduce the incidence of TD.
|
ACKNOWLEDGMENTS |
|---|
Received for publication March 23, 2008. Accepted for publication April 29, 2008.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bar, A., M. Shani, C. S. Fullmer, M. E. Brindak, and S. Striem. 1990. Modulation of chick intestinal and renal calbindin gene expression by dietary vitamin D3, 1,25-dihydroxyvitamin D3 calcium and phosphorus. Mol. Cell. Endocrinol. 72:23–31.[CrossRef][Web of Science][Medline]
Ben-Bassat, S., O. Genina, I. Lavelin, R. M. Leach, and M. Pines. 1999. Parathyroid receptor gene expression by epiphyseal growth plates in rickets and tibial dyschondroplasia. Mol. Cell. Endocrinol. 149:185–195.[CrossRef][Web of Science][Medline]
Bohensky, J., I. M. Shapiro, S. Leshinsky, S. P. Terkhorn, C. S. Adams, and V. Srinivas. 2007. HIF-1 regulation of chondrocyte apoptosis: Induction of the autophagic pathway. Autophagy 3:207–214.[Web of Science][Medline]
Even-Zohar, N., J. Jacob, N. Amariglio, G. Rehavi, O. Potievsky, M. Phillip, and G. Gat-Yablonsky. 2008. Nutrition-induced catch-up growth increases hypoxia inducible factor 1alpha RNA levels in the growth plate. Bone 42:505–515.[CrossRef][Web of Science][Medline]
Farquharson, C., and D. Jefferies. 2000. Chondrocytes and longitudinal bone growth: The development of tibial dyschon-droplasia. Poult. Sci. 79:994–1004.
Gay, C. V., R. E. Anderson, and R. M. Leach. 1985. Activities and distribution of alkaline phosphatase and carbonic anhydrase in the tibial dyschondroplastic lesion and associated growth plate of chicks. Avian Dis. 29:812–821.[CrossRef][Web of Science][Medline]
Gay, C. V., V. R. Gilman, and R. M. Leach. 2007. Immunolocalization of vascularization factors in normal, tibial dyschon-droplasia and rachitic cartilage. Avian Pathol. 36:445–451.[CrossRef][Web of Science][Medline]
Gerber, H. P., and N. Ferrara. 2000. Angiogenesis and bone growth. Trends Cardiovasc. Med. 10:223–228.[CrossRef][Web of Science][Medline]
Halevy, O., E. Monsonego, C. Marcelle, V. Hodik, A. Mett, and M. Pines. 1994. A new avian fibroblast growth factor receptor in myogenic and chondrogenic cell differentiation. Exp. Cell Res. 212:278–284.[CrossRef][Web of Science][Medline]
Hargest, T. E., R. M. Leach, and C. V. Gay. 1985. Avian tibial dyschondroplasia. I. Ultrastructure. Am. J. Pathol. 119:175–190.[Abstract]
Hatori, M., K. J. Klatte, C. C. Teixeira, and I. M. Shapiro. 1995. End labeling studies of fragmented DNA in the avian growth plate: Evidence of apoptosis in terminally differentiated chondrocytes. J. Bone Miner. Res. 10:1960–1968.[Web of Science][Medline]
Haynes, J. S., and M. M. Walser. 1982. Resistance of dyschon-droplastic cartilage to vascular invasion. Proc. Conf. Res. Workers Anim. Dis. 65:5. (Abstr.)
Hickey, M. M., and M. C. Simon. 2006. Regulation of angiogenesis by hypoxia and hypoxia-inducible factors. Curr. Top. Dev. Biol. 76:217–257.[Web of Science][Medline]
Howlett, C. R. 1979. The fine structure of the proximal growth plate of the avian tibia. J. Anat. 128:377–399.[Web of Science][Medline]
Huff, W. E. 1980. Evaluation of tibial dyschondroplasia during aflatoxicosis and feed restriction in young broiler chickens. Poult. Sci. 59:991–995.[Web of Science][Medline]
Kaelin, W. G., Jr. 2002. How oxygen makes its presence felt. Genes Dev. 16:1441–1445.
Kim, K. S., V. Rajagopal, C. Gonsalves, C. Johnson, and V. K. Kalra. 2006. A novel role of hypoxia-inducible factor in cobalt chloride- and hypoxia-mediated expression of IL-8 chemokine in human endothelial cells. J. Immunol. 177:7211–7224.
Lanneau, D., M. Brunet, E. Frisan, E. Solary, M. Fontenay, and C. Garrido. 2008. Heat shock proteins: Essential proteins for apoptosis regulation. J. Cell. Mol. Med. 12:743–761.[CrossRef][Web of Science][Medline]
Leach, M. R., and M. S. Lilburn. 1992. Current knowledge on the etiology of tibial dyschondroplasia in the avian species. Poult. Sci. Rev. 4:57–65.[Medline]
Leach, R. M., Jr., and C. V. Gay. 1987. Role of epiphyseal cartilage in endochondral bone formation. J. Nutr. 117:784–790.
Leach, R. M., Jr., and E. Monsonego-Ornan. 2007. Tibial dyschon-droplasia 40 years later. Poult. Sci. 86:2053–2058.
Monsonego, E., W. R. Baumbach, I. Lavelin, A. Gertler, S. Hurwitz, and M. Pines. 1997. Generation of growth hormone binding protein by avian growth plate chondrocytes is dependent on cell differentiation. Mol. Cell. Endocrinol. 135:1–10.[CrossRef][Web of Science][Medline]
NRC. 1984. Nutrient Requirements of Poultry. 8th ed. Natl. Acad. Press, Washington, DC.
Orth, M. W., and M. E. Cook. 1994. Avian tibial dyschon-droplasia: A morphological and biochemical review of the growth plate lesion and its cause. Vet. Pathol. 31:403–414.[Abstract]
Parcellier, A., S. Gurbuxani, E. Schmitt, E. Solary, and C. Garrido. 2003. Heat shock proteins, cellular chaperones that modulate mitochondrial cell death pathways. Biochem. Biophys. Res. Commun. 304:505–512.[CrossRef][Web of Science][Medline]
Pines, M., A. Hasdai, and E. Monsonego-Ornan. 2005. Tibial dyschondroplasia—Tools, new insights and future prospects. World’s Poult. Sci. J. 61:287–299.
Pines, M., and S. Hurwitz. 1988. The effect of parathyroid hormone and atrial natriuretic peptide on cyclic-nucleotide production and proliferation of avian epiphyseal growth plate chondroprogenitor cells. Endocrinology 123:360–365.
Pines, M., and S. Hurwitz. 1991. The role of the growth plate in longitudinal bone growth. Poult. Sci. 70:1806–1814.[Web of Science][Medline]
Pines, M., V. Knopov, O. Genina, S. Hurwitz, A. Faerman, L. C. Gerstenfeld, and R. M. Leach. 1998. Development of avian tibial dyschondroplasia: Gene expression and protein synthesis. Calcif. Tissue Int. 63:521–527.[CrossRef][Web of Science][Medline]
Praul, C. A., B. C. Ford, C. V. Gay, M. Pines, and R. M. Leach. 2000. Gene expression and tibial dyschondroplasia. Poult. Sci. 79:1009–1013.
Praul, C. A., C. V. Gay, and R. M. Leach. 1997. Chondrocytes of the tibial dyschondroplastic lesion are apoptotic. Int. J. Dev. Biol. 41:621–626.[Web of Science][Medline]
Provot, S., and E. Schipani. 2007. Fetal growth plate: A developmental model of cellular adaptation to hypoxia. Ann. N. Y. Acad. Sci. 1117:26–39.[CrossRef][Web of Science][Medline]
Rath, N. C., W. E. Huff, G. R. Bayyari, and J. M. Balog. 1998. Cell death in avian tibial dyschondroplasia. Avian Dis. 42:72–79.[CrossRef][Web of Science][Medline]
Rath, N. C., W. E. Huff, and G. R. Huff. 2007. Thiram-induced changes in the expression of genes relating to vascularization and tibial dyschondroplasia. Poult. Sci. 86:2390–2395.
Riddell, C. 1975. Studies on the pathogenesis of tibial dyschon-droplasia in chickens. I. Production of a similar defects by surgical interference. Avian Dis. 19:483–489.[CrossRef][Web of Science][Medline]
Riddell, C. 1977. Studies on the pathogenesis of tibial dyschon-droplasia in chickens. IV. Some features of the vascular supply to the growth plate of the tibiotarsus. Avian Dis. 21:9–15.[CrossRef][Web of Science][Medline]
Schipani, E. 2005. Hypoxia and HIF-1 alpha in chondrogenesis. Semin. Cell Dev. Biol. 16:539–546.[CrossRef][Web of Science][Medline]
Schipani, E., H. E. Ryan, S. Didrickson, T. Kobayashi, M. Knight, and R. S. Johnson. 2001. Hypoxia in cartilage: HIF-1 alpha is essential for chondrocyte growth arrest and survival. Genes Dev. 15:2865–2876.
Shapiro, I. M., K. D. Mansfield, S. M. Evans, E. M. Ford, and C. J. Koch. 1997. Chondrocytes in the endochondral growth cartilage are not hypoxic. Am. J. Physiol. 272:C1134–C1143.[Web of Science][Medline]
Su, G., P. Sorensen, and S. C. Kestin. 1999. Meal feeding is more effective than early feed restriction at reducing the prevalence of leg weakness in broiler chickens. Poult. Sci. 78:949–955.
Sullivan, T. W. 1994. Skeletal problems in poultry: Estimated annual cost and description. Poult. Sci. 73:879–882.[Web of Science][Medline]
Terkhorn, S. P., J. Bohensky, I. M. Shapiro, E. Koyama, and V. Srinivas. 2007. Expression of HIF prolyl hydroxylase isozymes in growth plate chondrocytes: Relationship between maturation and apoptotic sensitivity. J. Cell. Physiol. 210:257–265.[CrossRef][Web of Science][Medline]
Twal, W. O., J. Wu, C. V. Gay, and R. M. Leach. 1996. Immunolocalization of basic fibroblast growth factor in avian tibial dyschondroplasia cartilage. Poult. Sci. 75:130–134.[Web of Science][Medline]
Vanmuylder, N., L. Evrard, and N. Dourov. 1997. Strong expression of heat shock proteins in growth plate cartilage, an immunohistochemical study of HSP28, HSP70 and HSP110. Anat. Embryol. (Berl.) 195:359–362.[CrossRef][Medline]
Wang, X., G. J. Fosmire, C. V. Gay, and R. M. Leach. 2002. Short-term zinc deficiency inhibits chondrocyte proliferation and induces cell apoptosis in the epiphyseal growth plate of young chickens. J. Nutr. 132:665–673.
Wyers, M., Y. Cherel, and G. Plassiart. 1991. Late clinical expression of lameness related to associated osteomyelitis and tibial dyschondroplasia in male breeding turkeys. Avian Dis. 35:408–414.[CrossRef][Web of Science][Medline]
Yalcin, S., H. B. Molayo
lu, M. Baka, O. Genin, and M. Pines. 2007. Effect of temperature during the incubation period on tibial growth plate chondrocytes differentiation and the incidence of tibial dyschondroplasia. Poult. Sci. 86:1772–1783.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
